Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 503

AGAAGTTTGGAGACTCTTTCGTCTT T GAAGGCATGTTGAGCGAGCAAGTGA
AGAAGTTTGGAGACTCTTTCGTCTT C GAAGGCATGTTGAGCGAGCAAGTGA

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

XM_006506444.1:n.503T>C

Affected transcripts - 1

Affected proteins - 1

XM_006506444.1(Sumf1_i001):p.(=)

Reference protein

  1  MAAPAREPAL RCCIRLARVF LLLVLACEVA GSDEAEAREG AASLAGSCGC GTPQRAGAHG
61 SSAAAQRYSR EANAPGLTSG PRPLALTKMV PIPAGVFTMG TDDPQIRQDG EAPARRVTVD
121 GFYMDAYEVS NADFEKFVNS TGYLTEAEKF GDSFVFEGML SEQVKTHIHQ AVAAAPWWLP
181 VKGANWRHPE GPDSSILHRS NHPVLHVSWN DAVAYCTWAG KRLPTEAEWE YSCRGGLQNR
241 LFPWGNKLQP KGQHYANIWQ GKFPVSNTGE DGFQGTAPVD AFPPNGYGLY NIVGNVWEWT
301 SDWWTVHHSV EETFNPSGLV VVVVKQPVSP SEKIVQTWGV CAWSPSPCWQ DVTWRLLSEA
361 EIDFPCQIKA SACLEGAVQG SRILASCECS YLSICCGAQG SLAFTSATA*

Protein predicted from variant coding sequence

No change: predicted protein (not shown) equals reference protein.

Effects on Restriction sites

Raw variant Created Deleted
1 BbsI, BstBI, MboII, TaqI

Experimental services

Genomic description: 503T>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 36 1265 1 1230

CDS information

g. c.
Start 36 1
Stop 1265 1230

Links

Download this reference sequence file: XM_006506444.1.gb


Name ID Locus tag Product Link method
Sumf1_v001 XM_006506444.1 construction
Sumf1_i001 XP_006506507.1 formylglycine-generating enzyme isoform X1 construction

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.