Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1542

ATCACAGGCTGCTGCCCACGTGGCT G GCATTGCAGCCATGATGCTGTCTGC
ATCACAGGCTGCTGCCCACGTGGCT A GCATTGCAGCCATGATGCTGTCTGC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_174936.3:n.1542G>A

Affected transcripts - 1

Affected proteins - 1

NM_174936.3(PCSK9_i001):p.(Gly394Ser)

Reference protein

  1  MGTVSSRRSW WPLPLLLLLL LLLGPAGARA QEDEDGDYEE LVLALRSEED GLAEAPEHGT
61 TATFHRCAKD PWRLPGTYVV VLKEETHLSQ SERTARRLQA QAARRGYLTK ILHVFHGLLP
121 GFLVKMSGDL LELALKLPHV DYIEEDSSVF AQSIPWNLER ITPPRYRADE YQPPDGGSLV
181 EVYLLDTSIQ SDHREIEGRV MVTDFENVPE EDGTRFHRQA SKCDSHGTHL AGVVSGRDAG
241 VAKGASMRSL RVLNCQGKGT VSGTLIGLEF IRKSQLVQPV GPLVVLLPLA GGYSRVLNAA
301 CQRLARAGVV LVTAAGNFRD DACLYSPASA PEVITVGATN AQDQPVTLGT LGTNFGRCVD
361 LFAPGEDIIG ASSDCSTCFV SQSGTSQAAA HVAGIAAMML SAEPELTLAE LRQRLIHFSA
421 KDVINEAWFP EDQRVLTPNL VAALPPSTHG AGWQLFCRTV WSAHSGPTRM ATAVARCAPD
481 EELLSCSSFS RSGKRRGERM EAQGGKLVCR AHNAFGGEGV YAIARCCLLP QANCSVHTAP
541 PAEASMGTRV HCHQQGHVLT GCSSHWEVED LGTHKPPVLR PRGQPNQCVG HREASIHASC
601 CHAPGLECKV KEHGIPAPQE QVTVACEEGW TLTGCSALPG TSHVLGAYAV DNTCVVRSRD
661 VSTTGSTSEG AVTAVAICCR SRHLAQASQE LQ*

Protein predicted from variant coding sequence

  1  MGTVSSRRSW WPLPLLLLLL LLLGPAGARA QEDEDGDYEE LVLALRSEED GLAEAPEHGT
61 TATFHRCAKD PWRLPGTYVV VLKEETHLSQ SERTARRLQA QAARRGYLTK ILHVFHGLLP
121 GFLVKMSGDL LELALKLPHV DYIEEDSSVF AQSIPWNLER ITPPRYRADE YQPPDGGSLV
181 EVYLLDTSIQ SDHREIEGRV MVTDFENVPE EDGTRFHRQA SKCDSHGTHL AGVVSGRDAG
241 VAKGASMRSL RVLNCQGKGT VSGTLIGLEF IRKSQLVQPV GPLVVLLPLA GGYSRVLNAA
301 CQRLARAGVV LVTAAGNFRD DACLYSPASA PEVITVGATN AQDQPVTLGT LGTNFGRCVD
361 LFAPGEDIIG ASSDCSTCFV SQSGTSQAAA HVASIAAMML SAEPELTLAE LRQRLIHFSA
421 KDVINEAWFP EDQRVLTPNL VAALPPSTHG AGWQLFCRTV WSAHSGPTRM ATAVARCAPD
481 EELLSCSSFS RSGKRRGERM EAQGGKLVCR AHNAFGGEGV YAIARCCLLP QANCSVHTAP
541 PAEASMGTRV HCHQQGHVLT GCSSHWEVED LGTHKPPVLR PRGQPNQCVG HREASIHASC
601 CHAPGLECKV KEHGIPAPQE QVTVACEEGW TLTGCSALPG TSHVLGAYAV DNTCVVRSRD
661 VSTTGSTSEG AVTAVAICCR SRHLAQASQE LQ*

Effects on Restriction sites

Raw variant Created Deleted
1 BfaI, BmtI, NheI BstXI, LpnPI

Experimental services

Genomic description: 1542G>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 569 -362 207
2 570 761 208 399
3 762 885 400 523
4 886 1019 524 657
5 1020 1161 658 799
6 1162 1358 800 996
7 1359 1542 997 1180
8 1543 1716 1181 1354
9 1717 1865 1355 1503
10 1866 2043 1504 1681
11 2044 2225 1682 1863
12 2226 3710 1864 *1269

CDS information

g. c.
Start 363 1
Stop 2441 2079

Links

Download this reference sequence file: NM_174936.3.gb


Name ID Locus tag Product Link method
PCSK9_v001 NM_174936.3 exhaustion
PCSK9_i001 NP_777596.2 proprotein convertase subtilisin/kexin type 9 preproprotein exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.