Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 216

TATAAACTTGTGGTAGTTGGAGCTG G TGGCGTAGGCAAGAGTGCCTTGACG
TATAAACTTGTGGTAGTTGGAGCTG T TGGCGTAGGCAAGAGTGCCTTGACG

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_033360.2:n.216G>T

Affected transcripts - 1

Affected proteins - 1

NM_033360.2(KRAS_i001):p.(Gly12Val)

Reference protein

  1  MTEYKLVVVG AGGVGKSALT IQLIQNHFVD EYDPTIEDSY RKQVVIDGET CLLDILDTAG
61 QEEYSAMRDQ YMRTGEGFLC VFAINNTKSF EDIHHYREQI KRVKDSEDVP MVLVGNKCDL
121 PSRTVDTKQA QDLARSYGIP FIETSAKTRQ RVEDAFYTLV REIRQYRLKK ISKEEKTPGC
181 VKIKKCIIM*

Protein predicted from variant coding sequence

  1  MTEYKLVVVG AVGVGKSALT IQLIQNHFVD EYDPTIEDSY RKQVVIDGET CLLDILDTAG
61 QEEYSAMRDQ YMRTGEGFLC VFAINNTKSF EDIHHYREQI KRVKDSEDVP MVLVGNKCDL
121 PSRTVDTKQA QDLARSYGIP FIETSAKTRQ RVEDAFYTLV REIRQYRLKK ISKEEKTPGC
181 VKIKKCIIM*

Effects on Restriction sites

Raw variant Created Deleted
1 LpnPI

Experimental services

Genomic description: 216G>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 170 -181 -12
2 171 292 -11 111
3 293 471 112 290
4 472 631 291 450
5 632 755 451 *4
6 756 5421 *5 *4670

CDS information

g. c.
Start 182 1
Stop 751 570

Links

Download this reference sequence file: NM_033360.2.gb


Name ID Locus tag Product Link method
KRAS_v001 NM_033360.2 exhaustion
KRAS_i001 NP_203524.1 GTPase KRas isoform a precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.