Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: delins from 281 to 282

TCATCTTAAGGCAAATCATGTGGTC AA GAGAGATGTTGATGAGCATTTAAGA
TCATCTTAAGGCAAATCATGTGGTC GC GAGAGATGTTGATGAGCATTTAAGA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_033029.3:n.281_282delinsGC

Affected transcripts - 1

Affected proteins - 1

NM_033029.3(LMLN_i001):p.(Lys87Ala)

Reference protein

  1  MVTTLGPKMA AEWGGGVGYS GSGPGRSRWR WSGSVWVRSV LLLLGGLRAS ATSTPVSLGS
61 SPPCRHHVPS DTEVINKVHL KANHVVKRDV DEHLRIKTVY DKSVEELLPE KKNLVKNKLF
121 PQAISYLEKT FQVRRPAGTI LLSRQCATNQ YLRKENDPHR YCTGECAAHT KCGPVIVPEE
181 HLQQCRVYRG GKWPHGAVGV PDQEGISDAD FVLYVGALAT ERCSHENIIS YAAYCQQEAN
241 MDRPIAGYAN LCPNMISTQP QEFVGMLSTV KHEVIHALGF SAGLFAFYHD KDGNPLTSRF
301 ADGLPPFNYS LGLYQWSDKV VRKVERLWDV RDNKIVRHTV YLLVTPRVVE EARKHFDCPV
361 LEGMELENQG GVGTELNHWE KRLLENEAMT GSHTQNRVLS RITLALMEDT GRQMLSPYCD
421 TLRSNPLQLT CRQDQRAVAV CNLQKFPKPL PQEYQYFDEL SGIPAEDLPY YGGSVEIADY
481 CPFSQEFSWH LSGEYQRSSD CRILENQPEI FKNYGAEKYG PHSVCLIQKS AFVMEKCERK
541 LSYPDWGSGC YQVSCSPQGL KVWVQDTSYL CSRAGQVLPV SIQMNGWIHD GNLLCPSCWD
601 FCELCPPETD PPATNLTRAL PLDLCSCSSS LVVTLWLLLG NLFPLLAGFL LCIWH*

Protein predicted from variant coding sequence

  1  MVTTLGPKMA AEWGGGVGYS GSGPGRSRWR WSGSVWVRSV LLLLGGLRAS ATSTPVSLGS
61 SPPCRHHVPS DTEVINKVHL KANHVVARDV DEHLRIKTVY DKSVEELLPE KKNLVKNKLF
121 PQAISYLEKT FQVRRPAGTI LLSRQCATNQ YLRKENDPHR YCTGECAAHT KCGPVIVPEE
181 HLQQCRVYRG GKWPHGAVGV PDQEGISDAD FVLYVGALAT ERCSHENIIS YAAYCQQEAN
241 MDRPIAGYAN LCPNMISTQP QEFVGMLSTV KHEVIHALGF SAGLFAFYHD KDGNPLTSRF
301 ADGLPPFNYS LGLYQWSDKV VRKVERLWDV RDNKIVRHTV YLLVTPRVVE EARKHFDCPV
361 LEGMELENQG GVGTELNHWE KRLLENEAMT GSHTQNRVLS RITLALMEDT GRQMLSPYCD
421 TLRSNPLQLT CRQDQRAVAV CNLQKFPKPL PQEYQYFDEL SGIPAEDLPY YGGSVEIADY
481 CPFSQEFSWH LSGEYQRSSD CRILENQPEI FKNYGAEKYG PHSVCLIQKS AFVMEKCERK
541 LSYPDWGSGC YQVSCSPQGL KVWVQDTSYL CSRAGQVLPV SIQMNGWIHD GNLLCPSCWD
601 FCELCPPETD PPATNLTRAL PLDLCSCSSS LVVTLWLLLG NLFPLLAGFL LCIWH*

Effects on Restriction sites

Raw variant Created Deleted
1 BstUI, NruI

Experimental services

Genomic description: 281_282delinsGC

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 241 -22 219
2 242 339 220 317
3 340 370 318 348
4 371 453 349 431
5 454 571 432 549
6 572 750 550 728
7 751 856 729 834
8 857 951 835 929
9 952 1069 930 1047
10 1070 1177 1048 1155
11 1178 1254 1156 1232
12 1255 1387 1233 1365
13 1388 1547 1366 1525
14 1548 1678 1526 1656
15 1679 1889 1657 1867
16 1890 7043 1868 *5053

CDS information

g. c.
Start 23 1
Stop 1990 1968

Links

Download this reference sequence file: NM_033029.3.gb


Name ID Locus tag Product Link method
LMLN_v001 NM_033029.3 exhaustion
LMLN_i001 NP_149018.2 leishmanolysin-like peptidase isoform 2 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.