Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 771

CAGAGGAGGAGCCGGGTGGGCGGCA G CTCCTGGACCTCAATTGCTTTTTGT
CAGAGGAGGAGCCGGGTGGGCGGCA C CTCCTGGACCTCAATTGCTTTTTGT

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_032951.2:n.771G>C

Affected transcripts - 1

Affected proteins - 1

NM_032951.2(MLXIPL_i001):p.(Gln241His)

Reference protein

  1  MAGALAGLAA GLQVPRVAPS PDSDSDTDSE DPSLRRSAGG LLRSQVIHSG HFMVSSPHSD
61 SLPRRRDQEG SVGPSDFGPR SIDPTLTRLF ECLSLAYSGK LVSPKWKNFK GLKLLCRDKI
121 RLNNAIWRAW YIQYVKRRKS PVCGFVTPLQ GPEADAHRKP EAVVLEGNYW KRRIEVVMRE
181 YHKWRIYYKK RLRKPSREDD LLAPKQAEGR WPPPEQWCKQ LFSSVVPVLL GDPEEEPGGR
241 QLLDLNCFLS DISDTLFTMT QSGPSPLQLP PEDAYVGNAD MIQPDLTPLQ PSLDDFMDIS
301 DFFTNSRLPQ PPMPSNFPEP PSFSPVVDSL FSSGTLGPEV PPASSAMTHL SGHSRLQARN
361 SCPGPLDSSA FLSSDFLLPE DPKPRLPPPP VPPPLLHYPP PAKVPGLEPC PPPPFPPMAP
421 PTALLQEEPL FSPRFPFPTV PPAPGVSPLP APAAFPPTPQ SVPSPAPTPF PIELLPLGYS
481 EPAFGPCFSM PRGKPPAPSP RGQKASPPTL APATASPPTT AGSNNPCLTQ LLTAAKPEQA
541 LEPPLVSSTL LRSPGSPQET VPEFPCTFLP PTPAPTPPRP PPGPATLAPS RPLLVPKAER
601 LSPPAPSGSE RRLSGDLSSM PGPGTLSVRV SPPQPILSRG RPDSNKTENR RITHISAEQK
661 RRFNIKLGFD TLHGLVSTLS AQPSLKVSKA TTLQKTAEYI LMLQQERAGL QEEAQQLRDE
721 IEELNAAINL CQQQLPATGV PITHQRFDQM RDMFDDYVRT RTLHNWKFWV FSILIRPLFE
781 SFNGMVSTAS VHTLRQTSLA WLDQYCSLPA LRPTVLNSLR QLGTSTSILT DPGRIPEQAT
841 RAVTEGTLGK PL*

Protein predicted from variant coding sequence

  1  MAGALAGLAA GLQVPRVAPS PDSDSDTDSE DPSLRRSAGG LLRSQVIHSG HFMVSSPHSD
61 SLPRRRDQEG SVGPSDFGPR SIDPTLTRLF ECLSLAYSGK LVSPKWKNFK GLKLLCRDKI
121 RLNNAIWRAW YIQYVKRRKS PVCGFVTPLQ GPEADAHRKP EAVVLEGNYW KRRIEVVMRE
181 YHKWRIYYKK RLRKPSREDD LLAPKQAEGR WPPPEQWCKQ LFSSVVPVLL GDPEEEPGGR
241 HLLDLNCFLS DISDTLFTMT QSGPSPLQLP PEDAYVGNAD MIQPDLTPLQ PSLDDFMDIS
301 DFFTNSRLPQ PPMPSNFPEP PSFSPVVDSL FSSGTLGPEV PPASSAMTHL SGHSRLQARN
361 SCPGPLDSSA FLSSDFLLPE DPKPRLPPPP VPPPLLHYPP PAKVPGLEPC PPPPFPPMAP
421 PTALLQEEPL FSPRFPFPTV PPAPGVSPLP APAAFPPTPQ SVPSPAPTPF PIELLPLGYS
481 EPAFGPCFSM PRGKPPAPSP RGQKASPPTL APATASPPTT AGSNNPCLTQ LLTAAKPEQA
541 LEPPLVSSTL LRSPGSPQET VPEFPCTFLP PTPAPTPPRP PPGPATLAPS RPLLVPKAER
601 LSPPAPSGSE RRLSGDLSSM PGPGTLSVRV SPPQPILSRG RPDSNKTENR RITHISAEQK
661 RRFNIKLGFD TLHGLVSTLS AQPSLKVSKA TTLQKTAEYI LMLQQERAGL QEEAQQLRDE
721 IEELNAAINL CQQQLPATGV PITHQRFDQM RDMFDDYVRT RTLHNWKFWV FSILIRPLFE
781 SFNGMVSTAS VHTLRQTSLA WLDQYCSLPA LRPTVLNSLR QLGTSTSILT DPGRIPEQAT
841 RAVTEGTLGK PL*

Effects on Restriction sites

Raw variant Created Deleted
1 BanI AluI, AlwNI, ApeKI, BbvI, TseI

Experimental services

Genomic description: 771G>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 341 -48 293
2 342 448 294 400
3 449 531 401 483
4 532 621 484 573
5 622 666 574 618
6 667 868 619 820
7 869 949 821 901
8 950 1119 902 1071
9 1120 1651 1072 1603
10 1652 1719 1604 1671
11 1720 1870 1672 1822
12 1871 1986 1823 1938
13 1987 2106 1939 2058
14 2107 2234 2059 2186
15 2235 2358 2187 2310
16 2359 2488 2311 2440
17 2489 3278 2441 *671

CDS information

g. c.
Start 49 1
Stop 2607 2559

Links

Download this reference sequence file: NM_032951.2.gb


Name ID Locus tag Product Link method
MLXIPL_v001 NM_032951.2 exhaustion
MLXIPL_i001 NP_116569.1 carbohydrate-responsive element-binding protein isoform alpha exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.