Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 2019

CAGACCAGCAACTTGTTGAATGCCA G TTTTGACCACAGAAGAATATTCGAG
CAGACCAGCAACTTGTTGAATGCCA C TTTTGACCACAGAAGAATATTCGAG

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_032725.3:n.2019G>C

Affected transcripts - 1

Affected proteins - 1

NM_032725.3(BUD13_i001):p.(=)

Reference protein

  1  MAAAPPLSKA EYLKRYLSGA DAGVDRGSES GRKRRKKRPK PGGAGGKGMR IVDDDVSWTA
61 ISTTKLEKEE EEDDGDLPVV AEFVDERPEE VKQMEAFRSS AKWKLLGGHN EDLPSNRHFR
121 HDTPDSSPRR VRHGTPDPSP RKDRHDTPDP SPRRARHDTP DPSPLRGARH DSDTSPPRRI
181 RHDSSDTSPP RRARHDSPDP SPPRRPQHNS SGASPRRVRH DSPDPSPPRR ARHGSSDISS
241 PRRVHNNSPD TSRRTLGSSD TQQLRRARHD SPDLAPNVTY SLPRTKSGKA PERASSKTSP
301 HWKESGASHL SFPKNSKYEY DPDISPPRKK QAKSHFGDKK QLDSKGDCQK ATDSDLSSPR
361 HKQSPGHQDS DSDLSPPRNR PRHRSSDSDL SPPRRRQRTK SSDSDLSPPR RSQPPGKKAA
421 HMYSGAKTGL VLTDIQREQQ ELKEQDQETM AFEAEFQYAE TVFRDKSGRK RNLKLERLEQ
481 RRKAEKDSER DELYAQWGKG LAQSRQQQQN VEDAMKEMQK PLARYIDDED LDRMLREQER
541 EGDPMANFIK KNKAKENKNK KVRPRYSGPA PPPNRFNIWP GYRWDGVDRS NGFEQKRFAR
601 LASKKAVEEL AYKWSVEDM*

Protein predicted from variant coding sequence

No change: predicted protein (not shown) equals reference protein.

Effects on Restriction sites

Raw variant Created Deleted
1 BsrI

Experimental services

Genomic description: 2019G>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 177 -34 143
2 178 271 144 237
3 272 356 238 322
4 357 1070 323 1036
5 1071 1288 1037 1254
6 1289 1394 1255 1360
7 1395 1533 1361 1499
8 1534 1718 1500 1684
9 1719 1800 1685 1766
10 1801 2206 1767 *312

CDS information

g. c.
Start 35 1
Stop 1894 1860

Links

Download this reference sequence file: NM_032725.3.gb


Name ID Locus tag Product Link method
BUD13_v001 NM_032725.3 exhaustion
BUD13_i001 NP_116114.1 BUD13 homolog isoform 1 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.