Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 4475

GTGCAGCTCTTCAAGGGGAAATTCT T CCACTGCACTGACGAGTCCAAAGAG
GTGCAGCTCTTCAAGGGGAAATTCT G CCACTGCACTGACGAGTCCAAAGAG

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_023035.3:n.4475T>G

Affected transcripts - 1

Affected proteins - 1

NM_023035.3(CACNA1A_i001):p.(Phe1407Cys)

Reference protein

   1  MARFGDEMPA RYGGGGSGAA AGVVVGSGGG RGAGGSRQGG QPGAQRMYKQ SMAQRARTMA
61 LYNPIPVRQN CLTVNRSLFL FSEDNVVRKY AKKITEWPPF EYMILATIIA NCIVLALEQH
121 LPDDDKTPMS ERLDDTEPYF IGIFCFEAGI KIIALGFAFH KGSYLRNGWN VMDFVVVLTG
181 ILATVGTEFD LRTLRAVRVL RPLKLVSGIP SLQVVLKSIM KAMIPLLQIG LLLFFAILIF
241 AIIGLEFYMG KFHTTCFEEG TDDIQGESPA PCGTEEPART CPNGTKCQPY WEGPNNGITQ
301 FDNILFAVLT VFQCITMEGW TDLLYNSNDA SGNTWNWLYF IPLIIIGSFF MLNLVLGVLS
361 GEFAKERERV ENRRAFLKLR RQQQIERELN GYMEWISKAE EVILAEDETD GEQRHPFDGA
421 LRRTTIKKSK TDLLNPEEAE DQLADIASVG SPFARASIKS AKLENSTFFH KKERRMRFYI
481 RRMVKTQAFY WTVLSLVALN TLCVAIVHYN QPEWLSDFLY YAEFIFLGLF MSEMFIKMYG
541 LGTRPYFHSS FNCFDCGVII GSIFEVIWAV IKPGTSFGIS VLRALRLLRI FKVTKYWASL
601 RNLVVSLLNS MKSIISLLFL LFLFIVVFAL LGMQLFGGQF NFDEGTPPTN FDTFPAAIMT
661 VFQILTGEDW NEVMYDGIKS QGGVQGGMVF SIYFIVLTLF GNYTLLNVFL AIAVDNLANA
721 QELTKVEADE QEEEEAANQK LALQKAKEVA EVSPLSAANM SIAVKEQQKN QKPAKSVWEQ
781 RTSEMRKQNL LASREALYNE MDPDERWKAA YTRHLRPDMK THLDRPLVVD PQENRNNNTN
841 KSRAAEPTVD QRLGQQRAED FLRKQARYHD RARDPSGSAG LDARRPWAGS QEAELSREGP
901 YGRESDHHAR EGSLEQPGFW EGEAERGKAG DPHRRHVHRQ GGSRESRSGS PRTGADGEHR
961 RHRAHRRPGE EGPEDKAERR ARHREGSRPA RGGEGEGEGP DGGERRRRHR HGAPATYEGD
1021 ARREDKERRH RRRKENQGSG VPVSGPNLST TRPIQQDLGR QDPPLAEDID NMKNNKLATA
1081 ESAAPHGSLG HAGLPQSPAK MGNSTDPGPM LAIPAMATNP QNAASRRTPN NPGNPSNPGP
1141 PKTPENSLIV TNPSGTQTNS AKTARKPDHT TVDIPPACPP PLNHTVVQVN KNANPDPLPK
1201 KEEEKKEEEE DDRGEDGPKP MPPYSSMFIL STTNPLRRLC HYILNLRYFE MCILMVIAMS
1261 SIALAAEDPV QPNAPRNNVL RYFDYVFTGV FTFEMVIKMI DLGLVLHQGA YFRDLWNILD
1321 FIVVSGALVA FAFTGNSKGK DINTIKSLRV LRVLRPLKTI KRLPKLKAVF DCVVNSLKNV
1381 FNILIVYMLF MFIFAVVAVQ LFKGKFFHCT DESKEFEKDC RGKYLLYEKN EVKARDREWK
1441 KYEFHYDNVL WALLTLFTVS TGEGWPQVLK HSVDATFENQ GPSPGYRMEM SIFYVVYFVV
1501 FPFFFVNIFV ALIIITFQEQ GDKMMEEYSL EKNERACIDF AISAKPLTRH MPQNKQSFQY
1561 RMWQFVVSPP FEYTIMAMIA LNTIVLMMKF YGASVAYENA LRVFNIVFTS LFSLECVLKV
1621 MAFGILNYFR DAWNIFDFVT VLGSITDILV TEFGNPNNFI NLSFLRLFRA ARLIKLLRQG
1681 YTIRILLWTF VQSFKALPYV CLLIAMLFFI YAIIGMQVFG NIGIDVEDED SDEDEFQITE
1741 HNNFRTFFQA LMLLFRSATG EAWHNIMLSC LSGKPCDKNS GILTRECGNE FAYFYFVSFI
1801 FLCSFLMLNL FVAVIMDNFE YLTRDSSILG PHHLDEYVRV WAEYDPAAWG RMPYLDMYQM
1861 LRHMSPPLGL GKKCPARVAY KRLLRMDLPV ADDNTVHFNS TLMALIRTAL DIKIAKGGAD
1921 KQQMDAELRK EMMAIWPNLS QKTLDLLVTP HKSTDLTVGK IYAAMMIMEY YRQSKAKKLQ
1981 AMREEQDRTP LMFQRMEPPS PTQEGGPGQN ALPSTQLDPG GALMAHESGL KESPSWVTQR
2041 AQEMFQKTGT WSPEQGPPTD MPNSQPNSQS VEMREMGRDG YSDSEHYLPM EGQGRAASMP
2101 RLPAENQRRR GRPRGNNLST ISDTSPMKRS ASVLGPKARR LDDYSLERVP PEENQRHHQR
2161 RRDRSHRASE RSLGRYTDVD TGLGTDLSMT TQSGDLPSKE RDQERGRPKD RKHRQHHHHH
2221 HHHHHPPPPD KDRYAQERPD HGRARARDQR WSRSPSEGRE HMAHRQGSSS VSGSPAPSTS
2281 GTSTPRRGRR QLPQTPSTPR PHVSYSPVIR KAGGSGPPQQ QQQQQQQQQQ QAVARPGRAA
2341 TSGPRRYPGP TAEPLAGDRP PTGGHSSGRS PRMERRVPGP ARSESPRACR HGGARWPASG
2401 PHVSEGPPGP RHHGYYRGSD YDEADGPGSG GGEEAMAGAY DAPPPVRHAS SGATGRSPRT
2461 PRASGPACAS PSRHGRRLPN GYYPAHGLAR PRGPGSRKGL HEPYSESDDD WC*

Protein predicted from variant coding sequence

   1  MARFGDEMPA RYGGGGSGAA AGVVVGSGGG RGAGGSRQGG QPGAQRMYKQ SMAQRARTMA
61 LYNPIPVRQN CLTVNRSLFL FSEDNVVRKY AKKITEWPPF EYMILATIIA NCIVLALEQH
121 LPDDDKTPMS ERLDDTEPYF IGIFCFEAGI KIIALGFAFH KGSYLRNGWN VMDFVVVLTG
181 ILATVGTEFD LRTLRAVRVL RPLKLVSGIP SLQVVLKSIM KAMIPLLQIG LLLFFAILIF
241 AIIGLEFYMG KFHTTCFEEG TDDIQGESPA PCGTEEPART CPNGTKCQPY WEGPNNGITQ
301 FDNILFAVLT VFQCITMEGW TDLLYNSNDA SGNTWNWLYF IPLIIIGSFF MLNLVLGVLS
361 GEFAKERERV ENRRAFLKLR RQQQIERELN GYMEWISKAE EVILAEDETD GEQRHPFDGA
421 LRRTTIKKSK TDLLNPEEAE DQLADIASVG SPFARASIKS AKLENSTFFH KKERRMRFYI
481 RRMVKTQAFY WTVLSLVALN TLCVAIVHYN QPEWLSDFLY YAEFIFLGLF MSEMFIKMYG
541 LGTRPYFHSS FNCFDCGVII GSIFEVIWAV IKPGTSFGIS VLRALRLLRI FKVTKYWASL
601 RNLVVSLLNS MKSIISLLFL LFLFIVVFAL LGMQLFGGQF NFDEGTPPTN FDTFPAAIMT
661 VFQILTGEDW NEVMYDGIKS QGGVQGGMVF SIYFIVLTLF GNYTLLNVFL AIAVDNLANA
721 QELTKVEADE QEEEEAANQK LALQKAKEVA EVSPLSAANM SIAVKEQQKN QKPAKSVWEQ
781 RTSEMRKQNL LASREALYNE MDPDERWKAA YTRHLRPDMK THLDRPLVVD PQENRNNNTN
841 KSRAAEPTVD QRLGQQRAED FLRKQARYHD RARDPSGSAG LDARRPWAGS QEAELSREGP
901 YGRESDHHAR EGSLEQPGFW EGEAERGKAG DPHRRHVHRQ GGSRESRSGS PRTGADGEHR
961 RHRAHRRPGE EGPEDKAERR ARHREGSRPA RGGEGEGEGP DGGERRRRHR HGAPATYEGD
1021 ARREDKERRH RRRKENQGSG VPVSGPNLST TRPIQQDLGR QDPPLAEDID NMKNNKLATA
1081 ESAAPHGSLG HAGLPQSPAK MGNSTDPGPM LAIPAMATNP QNAASRRTPN NPGNPSNPGP
1141 PKTPENSLIV TNPSGTQTNS AKTARKPDHT TVDIPPACPP PLNHTVVQVN KNANPDPLPK
1201 KEEEKKEEEE DDRGEDGPKP MPPYSSMFIL STTNPLRRLC HYILNLRYFE MCILMVIAMS
1261 SIALAAEDPV QPNAPRNNVL RYFDYVFTGV FTFEMVIKMI DLGLVLHQGA YFRDLWNILD
1321 FIVVSGALVA FAFTGNSKGK DINTIKSLRV LRVLRPLKTI KRLPKLKAVF DCVVNSLKNV
1381 FNILIVYMLF MFIFAVVAVQ LFKGKFCHCT DESKEFEKDC RGKYLLYEKN EVKARDREWK
1441 KYEFHYDNVL WALLTLFTVS TGEGWPQVLK HSVDATFENQ GPSPGYRMEM SIFYVVYFVV
1501 FPFFFVNIFV ALIIITFQEQ GDKMMEEYSL EKNERACIDF AISAKPLTRH MPQNKQSFQY
1561 RMWQFVVSPP FEYTIMAMIA LNTIVLMMKF YGASVAYENA LRVFNIVFTS LFSLECVLKV
1621 MAFGILNYFR DAWNIFDFVT VLGSITDILV TEFGNPNNFI NLSFLRLFRA ARLIKLLRQG
1681 YTIRILLWTF VQSFKALPYV CLLIAMLFFI YAIIGMQVFG NIGIDVEDED SDEDEFQITE
1741 HNNFRTFFQA LMLLFRSATG EAWHNIMLSC LSGKPCDKNS GILTRECGNE FAYFYFVSFI
1801 FLCSFLMLNL FVAVIMDNFE YLTRDSSILG PHHLDEYVRV WAEYDPAAWG RMPYLDMYQM
1861 LRHMSPPLGL GKKCPARVAY KRLLRMDLPV ADDNTVHFNS TLMALIRTAL DIKIAKGGAD
1921 KQQMDAELRK EMMAIWPNLS QKTLDLLVTP HKSTDLTVGK IYAAMMIMEY YRQSKAKKLQ
1981 AMREEQDRTP LMFQRMEPPS PTQEGGPGQN ALPSTQLDPG GALMAHESGL KESPSWVTQR
2041 AQEMFQKTGT WSPEQGPPTD MPNSQPNSQS VEMREMGRDG YSDSEHYLPM EGQGRAASMP
2101 RLPAENQRRR GRPRGNNLST ISDTSPMKRS ASVLGPKARR LDDYSLERVP PEENQRHHQR
2161 RRDRSHRASE RSLGRYTDVD TGLGTDLSMT TQSGDLPSKE RDQERGRPKD RKHRQHHHHH
2221 HHHHHPPPPD KDRYAQERPD HGRARARDQR WSRSPSEGRE HMAHRQGSSS VSGSPAPSTS
2281 GTSTPRRGRR QLPQTPSTPR PHVSYSPVIR KAGGSGPPQQ QQQQQQQQQQ QAVARPGRAA
2341 TSGPRRYPGP TAEPLAGDRP PTGGHSSGRS PRMERRVPGP ARSESPRACR HGGARWPASG
2401 PHVSEGPPGP RHHGYYRGSD YDEADGPGSG GGEEAMAGAY DAPPPVRHAS SGATGRSPRT
2461 PRASGPACAS PSRHGRRLPN GYYPAHGLAR PRGPGSRKGL HEPYSESDDD WC*

Effects on Restriction sites

Raw variant Created Deleted
1 MboII, XmnI

Experimental services

Genomic description: 4475T>G

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 548 -255 293
2 549 654 294 399
3 655 794 400 539
4 795 886 540 631
5 887 1039 632 784
6 1040 1233 785 978
7 1234 1337 979 1082
8 1338 1453 1083 1198
9 1454 1510 1199 1255
10 1511 1603 1256 1348
11 1604 1813 1349 1558
12 1814 1926 1559 1671
13 1927 2039 1672 1784
14 2040 2171 1785 1916
15 2172 2244 1917 1989
16 2245 2362 1990 2107
17 2363 2439 2108 2184
18 2440 2546 2185 2291
19 2547 3356 2292 3101
20 3357 3820 3102 3565
21 3821 3959 3566 3704
22 3960 4089 3705 3834
23 4090 4149 3835 3894
24 4150 4256 3895 4001
25 4257 4356 4002 4101
26 4357 4517 4102 4262
27 4518 4655 4263 4400
28 4656 4857 4401 4602
29 4858 5022 4603 4767
30 5023 5133 4768 4878
31 5134 5217 4879 4962
32 5218 5223 4963 4968
33 5224 5340 4969 5085
34 5341 5406 5086 5151
35 5407 5522 5152 5267
36 5523 5673 5268 5418
37 5674 5801 5419 5546
38 5802 5898 5547 5643
39 5899 6004 5644 5749
40 6005 6112 5750 5857
41 6113 6213 5858 5958
42 6214 6323 5959 6068
43 6324 6462 6069 6207
44 6463 6576 6208 6321
45 6577 6612 6322 6357
46 6613 6799 6358 6544
47 6800 7053 6545 6798
48 7054 8665 6799 *871

CDS information

g. c.
Start 256 1
Stop 7794 7539

Links

Download this reference sequence file: NM_023035.3.gb


Name ID Locus tag Product Link method
CACNA1A_v001 NM_023035.3 exhaustion
CACNA1A_i001 NP_075461.2 voltage-dependent P/Q-type calcium channel subunit alpha-1A isoform 2 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.