Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1482

GCATCGAGCTGTACCTGAGGAAGCG C CATCATGAGCCCGGGGTGGCGGACC
GCATCGAGCTGTACCTGAGGAAGCG A CATCATGAGCCCGGGGTGGCGGACC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_022162.1:n.1482C>A

Affected transcripts - 1

Affected proteins - 1

NM_022162.1(NOD2_i001):p.(=)

Reference protein

   1  MGEEGGSASH DEEERASVLL GHSPGCEMCS QEAFQAQRSQ LVELLVSGSL EGFESVLDWL
61 LSWEVLSWED YEGFHLLGQP LSHLARRLLD TVWNKGTWAC QKLIAAAQEA QADSQSPKLH
121 GCWDPHSLHP ARDLQSHRPA IVRRLHSHVE NMLDLAWERG FVSQYECDEI RLPIFTPSQR
181 ARRLLDLATV KANGLAAFLL QHVQELPVPL ALPLEAATCK KYMAKLRTTV SAQSRFLSTY
241 DGAETLCLED IYTENVLEVW ADVGMAGPPQ KSPATLGLEE LFSTPGHLND DADTVLVVGE
301 AGSGKSTLLQ RLHLLWAAGQ DFQEFLFVFP FSCRQLQCMA KPLSVRTLLF EHCCWPDVGQ
361 EDIFQLLLDH PDRVLLTFDG FDEFKFRFTD RERHCSPTDP TSVQTLLFNL LQGNLLKNAR
421 KVVTSRPAAV SAFLRKYIRT EFNLKGFSEQ GIELYLRKRH HEPGVADRLI RLLQETSALH
481 GLCHLPVFSW MVSKCHQELL LQEGGSPKTT TDMYLLILQH FLLHATPPDS ASQGLGPSLL
541 RGRLPTLLHL GRLALWGLGM CCYVFSAQQL QAAQVSPDDI SLGFLVRAKG VVPGSTAPLE
601 FLHITFQCFF AAFYLALSAD VPPALLRHLF NCGRPGNSPM ARLLPTMCIQ ASEGKDSSVA
661 ALLQKAEPHN LQITAAFLAG LLSREHWGLL AECQTSEKAL LRRQACARWC LARSLRKHFH
721 SIPPAAPGEA KSVHAMPGFI WLIRSLYEMQ EERLARKAAR GLNVGHLKLT FCSVGPTECA
781 ALAFVLQHLR RPVALQLDYN SVGDIGVEQL LPCLGVCKAL YLRDNNISDR GICKLIECAL
841 HCEQLQKLAL FNNKLTDGCA HSMAKLLACR QNFLALRLGN NYITAAGAQV LAEGLRGNTS
901 LQFLGFWGNR VGDEGAQALA EALGDHQSLR WLSLVGNNIG SVGAQALALM LAKNVMLEEL
961 CLEENHLQDE GVCSLAEGLK KNSSLKILKL SNNCITYLGA EALLQALERN DTILEVWLRG
1021 NTFSLEEVDK LGCRDTRLLL *

Protein predicted from variant coding sequence

No change: predicted protein (not shown) equals reference protein.

Effects on Restriction sites

Raw variant Created Deleted
1 BccI, HaeII, HhaI, HinP1I

Experimental services

Genomic description: 1482C>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 106 3228 1 3123

CDS information

g. c.
Start 106 1
Stop 3228 3123

Links

Download this reference sequence file: NM_022162.1.gb


Name ID Locus tag Product Link method
NOD2_v001 NM_022162.1 construction
NOD2_i001 NP_071445.1 nucleotide-binding oligomerization domain-containing protein 2 construction

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.