Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 217

GGACTGCTGCAGTAAGAATGTCTTT T CCACCTCATTTGAATCGCCCTCCCA
GGACTGCTGCAGTAAGAATGTCTTT A CCACCTCATTTGAATCGCCCTCCCA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_021239.2:n.217T>A

Affected transcripts - 1

Affected proteins - 1

NM_021239.2(RBM25_i001):p.(Phe3Leu)

Reference protein

  1  MSFPPHLNRP PMGIPALPPG IPPPQFPGFP PPVPPGTPMI PVPMSIMAPA PTVLVPTVSM
61 VGKHLGARKD HPGLKAKEND ENCGPTTTVF VGNISEKASD MLIRQLLAKC GLVLSWKRVQ
121 GASGKLQAFG FCEYKEPEST LRALRLLHDL QIGEKKLLVK VDAKTKAQLD EWKAKKKASN
181 GNARPETVTN DDEEALDEET KRRDQMIKGA IEVLIREYSS ELNAPSQESD SHPRKKKKEK
241 KEDIFRRFPV APLIPYPLIT KEDINAIEME EDKRDLISRE ISKFRDTHKK LEEEKGKKEK
301 ERQEIEKERR ERERERERER ERRERERERE REREREKEKE RERERERDRD RDRTKERDRD
361 RDRERDRDRD RERSSDRNKD RSRSREKSRD RERERERERE RERERERERE RERERERERE
421 REREREKDKK RDREEDEEDA YERRKLERKL REKEAAYQER LKNWEIRERK KTREYEKEAE
481 REEERRREMA KEAKRLKEFL EDYDDDRDDP KYYRGSALQK RLRDREKEME ADERDRKREK
541 EELEEIRQRL LAEGHPDPDA ELQRMEQEAE RRRQPQIKQE PESEEEEEEK QEKEEKREEP
601 MEEEEEPEQK PCLKPTLRPI SSAPSVSSAS GNATPNTPGD ESPCGIIIPH ENSPDQQQPE
661 EHRPKIGLSL KLGASNSPGQ PNSVKRKKLP VDSVFNKFED EDSDDVPRKR KLVPLDYGED
721 DKNATKGTVN TEEKRKHIKS LIEKIPTAKP ELFAYPLDWS IVDSILMERR IRPWINKKII
781 EYIGEEEATL VDFVCSKVMA HSSPQSILDD VAMVLDEEAE VFIVKMWRLL IYETEAKKIG
841 LVK*

Protein predicted from variant coding sequence

  1  MSLPPHLNRP PMGIPALPPG IPPPQFPGFP PPVPPGTPMI PVPMSIMAPA PTVLVPTVSM
61 VGKHLGARKD HPGLKAKEND ENCGPTTTVF VGNISEKASD MLIRQLLAKC GLVLSWKRVQ
121 GASGKLQAFG FCEYKEPEST LRALRLLHDL QIGEKKLLVK VDAKTKAQLD EWKAKKKASN
181 GNARPETVTN DDEEALDEET KRRDQMIKGA IEVLIREYSS ELNAPSQESD SHPRKKKKEK
241 KEDIFRRFPV APLIPYPLIT KEDINAIEME EDKRDLISRE ISKFRDTHKK LEEEKGKKEK
301 ERQEIEKERR ERERERERER ERRERERERE REREREKEKE RERERERDRD RDRTKERDRD
361 RDRERDRDRD RERSSDRNKD RSRSREKSRD RERERERERE RERERERERE RERERERERE
421 REREREKDKK RDREEDEEDA YERRKLERKL REKEAAYQER LKNWEIRERK KTREYEKEAE
481 REEERRREMA KEAKRLKEFL EDYDDDRDDP KYYRGSALQK RLRDREKEME ADERDRKREK
541 EELEEIRQRL LAEGHPDPDA ELQRMEQEAE RRRQPQIKQE PESEEEEEEK QEKEEKREEP
601 MEEEEEPEQK PCLKPTLRPI SSAPSVSSAS GNATPNTPGD ESPCGIIIPH ENSPDQQQPE
661 EHRPKIGLSL KLGASNSPGQ PNSVKRKKLP VDSVFNKFED EDSDDVPRKR KLVPLDYGED
721 DKNATKGTVN TEEKRKHIKS LIEKIPTAKP ELFAYPLDWS IVDSILMERR IRPWINKKII
781 EYIGEEEATL VDFVCSKVMA HSSPQSILDD VAMVLDEEAE VFIVKMWRLL IYETEAKKIG
841 LVK*

Effects on Restriction sites

Raw variant Created Deleted
1

Experimental services

Genomic description: 217T>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 193 -208 -16
2 194 314 -15 106
3 315 364 107 156
4 365 532 157 324
5 533 590 325 382
6 591 751 383 543
7 752 937 544 729
8 938 991 730 783
9 992 1075 784 867
10 1076 1362 868 1154
11 1363 1585 1155 1377
12 1586 1675 1378 1467
13 1676 1749 1468 1541
14 1750 1900 1542 1692
15 1901 2225 1693 2017
16 2226 2500 2018 2292
17 2501 2599 2293 2391
18 2600 2647 2392 2439
19 2648 4303 2440 *1563

CDS information

g. c.
Start 209 1
Stop 2740 2532

Links

Download this reference sequence file: NM_021239.2.gb


Name ID Locus tag Product Link method
RBM25_v001 NM_021239.2 exhaustion
RBM25_i001 NP_067062.1 RNA-binding protein 25 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.