Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1664

AATGAAACGTTCATCATCCACTTAG A CAATGGAAGAGGGTTTGGGAAGTAT
AATGAAACGTTCATCATCCACTTAG C CAATGGAAGAGGGTTTGGGAAGTAT

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_020223.3:n.1664A>C

Affected transcripts - 1

Affected proteins - 1

NM_020223.3(FAM20C_i001):p.(Asp478Ala)

Reference protein

  1  MKMMLVRRFR VLILMVFLVA CALHIALDLL PRLERRGARP SGEPGCSCAQ PAAEVAAPGW
61 AQVRGRPGEP PAASSAAGDA GWPNKHTLRI LQDFSSDPSS NLSSHSLEKL PPAAEPAERA
121 LRGRDPGALR PHDPAHRPLL RDPGPRRSES PPGPGGDASL LARLFEHPLY RVAVPPLTEE
181 DVLFNVNSDT RLSPKAAENP DWPHAGAEGA EFLSPGEAAV DSYPNWLKFH IGINRYELYS
241 RHNPAIEALL HDLSSQRITS VAMKSGGTQL KLIMTFQNYG QALFKPMKQT REQETPPDFF
301 YFSDYERHNA EIAAFHLDRI LDFRRVPPVA GRMVNMTKEI RDVTRDKKLW RTFFISPANN
361 ICFYGECSYY CSTEHALCGK PDQIEGSLAA FLPDLSLAKR KTWRNPWRRS YHKRKKAEWE
421 VDPDYCEEVK QTPPYDSSHR ILDVMDMTIF DFLMGNMDRH HYETFEKFGN ETFIIHLDNG
481 RGFGKYSHDE LSILVPLQQC CRIRKSTYLR LQLLAKEEYK LSLLMAESLR GDQVAPVLYQ
541 PHLEALDRRL RVVLKAVRDC VERNGLHSVV DDDLDTEHRA ASAR*

Protein predicted from variant coding sequence

  1  MKMMLVRRFR VLILMVFLVA CALHIALDLL PRLERRGARP SGEPGCSCAQ PAAEVAAPGW
61 AQVRGRPGEP PAASSAAGDA GWPNKHTLRI LQDFSSDPSS NLSSHSLEKL PPAAEPAERA
121 LRGRDPGALR PHDPAHRPLL RDPGPRRSES PPGPGGDASL LARLFEHPLY RVAVPPLTEE
181 DVLFNVNSDT RLSPKAAENP DWPHAGAEGA EFLSPGEAAV DSYPNWLKFH IGINRYELYS
241 RHNPAIEALL HDLSSQRITS VAMKSGGTQL KLIMTFQNYG QALFKPMKQT REQETPPDFF
301 YFSDYERHNA EIAAFHLDRI LDFRRVPPVA GRMVNMTKEI RDVTRDKKLW RTFFISPANN
361 ICFYGECSYY CSTEHALCGK PDQIEGSLAA FLPDLSLAKR KTWRNPWRRS YHKRKKAEWE
421 VDPDYCEEVK QTPPYDSSHR ILDVMDMTIF DFLMGNMDRH HYETFEKFGN ETFIIHLANG
481 RGFGKYSHDE LSILVPLQQC CRIRKSTYLR LQLLAKEEYK LSLLMAESLR GDQVAPVLYQ
541 PHLEALDRRL RVVLKAVRDC VERNGLHSVV DDDLDTEHRA ASAR*

Effects on Restriction sites

Raw variant Created Deleted
1 CviKI_1

Experimental services

Genomic description: 1664A>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 836 -231 605
2 837 1015 606 784
3 1016 1094 785 863
4 1095 1187 864 956
5 1188 1303 957 1072
6 1304 1484 1073 1253
7 1485 1594 1254 1363
8 1595 1676 1364 1445
9 1677 1736 1446 1505
10 1737 2780 1506 *794

CDS information

g. c.
Start 232 1
Stop 1986 1755

Links

Download this reference sequence file: NM_020223.3.gb


Name ID Locus tag Product Link method
FAM20C_v001 NM_020223.3 exhaustion
FAM20C_i001 NP_064608.2 extracellular serine/threonine protein kinase FAM20C precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.