Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: delins from 224 to 225

CATGAAGACTAAAGCATCTGTCAGA AA AAGCTTCAGTGAAGATGTGTTCCAG
CATGAAGACTAAAGCATCTGTCAGA GC AAGCTTCAGTGAAGATGTGTTCCAG

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_016248.3:n.224_225delinsGC

Affected transcripts - 1

Affected proteins - 1

NM_016248.3(AKAP11_i001):p.(Lys17Ala)

Reference protein

   1  MATFRNNHMK TKASVRKSFS EDVFQSVKSL LQSQKELCSV TAEDCLQQDE HANLTEVTFL
61 GFNEETDAAH IQDLAAVSLE LPDILNSLHF CSLNENEIIC MKNINKPLDI SSDPLNQSHP
121 SGMLCVMRVS PTSPRLRIDF IFSLLSKYAT GIRYTLDTFL HQKHQLETTD EDDDDTNQSV
181 SSIEDDFVTA FEHLEEEETS KPYNDGMNIT VLRSQCDAAS QTVTGHHLET HDLKILISSG
241 QQKSLAKPST SSVNVLGHKE LPSVKTSVTT SISEPWTQRS FYRSSNASDK DSDLQKTFFS
301 SSPAYSSESE CSSPSPVIFL DEEGYQKSLK AKLELPKIPV MKDDIEDSDS EVSEFFDSFD
361 QFDELEQTLE TCLFNKDPVI GKSSQRKGHK HGKSCMNPQK FKFDRPALPA NVRKPTPRKP
421 ESPYGNLCDA PDSPRPVKAS REDSGLFSPI RSSAFSPLGG CTPAECFCQT DIGGDRIHEN
481 HDSVYYTYED YAKSISCEVL GSVLRTHHTN TLSNINSIKH GENKTVTFKH GNLDQKNKSK
541 NKSLMIKDSI QKFAADLVEK SFGSAFKDLQ KGVSSCTNAL YHLAIKLTSS VLQMAFDELR
601 RQRAFSLKER AISGLANFLV SEALSNALKD LQYVKKQIFT NTVARFAADL AEELVFEGIM
661 EVCQFSYPQT PASPQCGSFD FEDKVVKLYA KDLSESVIQE AFIELSQVDV TFTTKAAVSV
721 STDNIKYVSA ESVVPSTQAV TFSPSFHNQA IMVTKPVQEY KKEYTVQQAL FCTSGIVTSI
781 PVPLAGSALL PYHISSTACQ AKAHLSSDDS NSNGDSAQVH IATKNREEKA ACLRNICLPS
841 EHNPGNQNDF KPTNDDIEMQ SSSKLPNDPA IISNFSAAVV HTIVNETLES MTSLEVTKMV
901 DERTDYLTKS LKEKTPPFSH CDQAVLQCSE ASSNKDMFAD RLSKSIIKHS IDKSKSVIPN
961 IDKNAVYKES LPVSGEESQL TPEKSPKFPD SQNQLTHCSL SAAKDCVPEC KVSMVHGSSL
1021 ETLPSCPAVT GQKSDLKESA KDQPLKKHNL NSTSLEALSF GQENPFPHSH TFSSTALTCV
1081 DGLHVEDKQK VRDRNVIPDT PPSTPLVPSR ASSEWDIKKL TKKLKGELAK EFAPATPPST
1141 PHNSSVGSLS ENEQNTIEKE EFMLKLMRSL SEEVESSESG ELPEVDVKSE HSGKKVQFAE
1201 ALATHILSLA TEMAASHLDN KIIQEPKVKN PCLNVQSQRS VSPTFLNPSD ENLKTLCNFA
1261 GDLAAEVITE AEKIAKVRNC MLFKQKKNSC YADGDEDYKV EEKLDIEAVV HPREVDPFIL
1321 SLPPSSCMSG LMYKYPSCES VTDEYAGHLI QILKQEGGNS ELIMDQYANR LAYRSVKSGL
1381 QEAAKTTKVQ CNSRMFPVPS SQVKTNKELL MFSNKEHHQE ADKKRQSKRN EGYFCKNQTC
1441 ERTLDPYRNE VSQLYSFSTS LVHSITKDAK EELTASLVGL PKSLTDSCLF EKSGYEEDNE
1501 CHVTPELPKS LQPSSQNHRF YHSTGSLNGY GCGDNVVQAV EQYAKKVVDD TLELTLGSTV
1561 FRVSETTKSA DRVTYAEKLS PLTGQACRYC DLKELHNCTG NSSQHFFRQG SLASSKPASN
1621 PKFSSRYQKS RIFHLSVPQI HVNLDKKAVL AEKIVAEAIE KAERELSSTS LAADSGIGQE
1681 GASFAESLAT ETMTAAVTNV GHAVSSSKEI EDFQSTESVS SQQMNLSIGD DSTGSWSNLS
1741 FEDEHQDESS SFHHLSESNG NSSSWSSLGL EGDLYEDNLS FPTSDSDGPD DKDEEHEDEV
1801 EGLGQDGKTL LITNIDMEPC TVDPQLRIIL QWLIASEAEV AELYFHDSAN KEFMLLSKQL
1861 QEKGWKVGDL LQAVLQYYEV MEKASSEERC KSLFDWLLEN A*

Protein predicted from variant coding sequence

   1  MATFRNNHMK TKASVRASFS EDVFQSVKSL LQSQKELCSV TAEDCLQQDE HANLTEVTFL
61 GFNEETDAAH IQDLAAVSLE LPDILNSLHF CSLNENEIIC MKNINKPLDI SSDPLNQSHP
121 SGMLCVMRVS PTSPRLRIDF IFSLLSKYAT GIRYTLDTFL HQKHQLETTD EDDDDTNQSV
181 SSIEDDFVTA FEHLEEEETS KPYNDGMNIT VLRSQCDAAS QTVTGHHLET HDLKILISSG
241 QQKSLAKPST SSVNVLGHKE LPSVKTSVTT SISEPWTQRS FYRSSNASDK DSDLQKTFFS
301 SSPAYSSESE CSSPSPVIFL DEEGYQKSLK AKLELPKIPV MKDDIEDSDS EVSEFFDSFD
361 QFDELEQTLE TCLFNKDPVI GKSSQRKGHK HGKSCMNPQK FKFDRPALPA NVRKPTPRKP
421 ESPYGNLCDA PDSPRPVKAS REDSGLFSPI RSSAFSPLGG CTPAECFCQT DIGGDRIHEN
481 HDSVYYTYED YAKSISCEVL GSVLRTHHTN TLSNINSIKH GENKTVTFKH GNLDQKNKSK
541 NKSLMIKDSI QKFAADLVEK SFGSAFKDLQ KGVSSCTNAL YHLAIKLTSS VLQMAFDELR
601 RQRAFSLKER AISGLANFLV SEALSNALKD LQYVKKQIFT NTVARFAADL AEELVFEGIM
661 EVCQFSYPQT PASPQCGSFD FEDKVVKLYA KDLSESVIQE AFIELSQVDV TFTTKAAVSV
721 STDNIKYVSA ESVVPSTQAV TFSPSFHNQA IMVTKPVQEY KKEYTVQQAL FCTSGIVTSI
781 PVPLAGSALL PYHISSTACQ AKAHLSSDDS NSNGDSAQVH IATKNREEKA ACLRNICLPS
841 EHNPGNQNDF KPTNDDIEMQ SSSKLPNDPA IISNFSAAVV HTIVNETLES MTSLEVTKMV
901 DERTDYLTKS LKEKTPPFSH CDQAVLQCSE ASSNKDMFAD RLSKSIIKHS IDKSKSVIPN
961 IDKNAVYKES LPVSGEESQL TPEKSPKFPD SQNQLTHCSL SAAKDCVPEC KVSMVHGSSL
1021 ETLPSCPAVT GQKSDLKESA KDQPLKKHNL NSTSLEALSF GQENPFPHSH TFSSTALTCV
1081 DGLHVEDKQK VRDRNVIPDT PPSTPLVPSR ASSEWDIKKL TKKLKGELAK EFAPATPPST
1141 PHNSSVGSLS ENEQNTIEKE EFMLKLMRSL SEEVESSESG ELPEVDVKSE HSGKKVQFAE
1201 ALATHILSLA TEMAASHLDN KIIQEPKVKN PCLNVQSQRS VSPTFLNPSD ENLKTLCNFA
1261 GDLAAEVITE AEKIAKVRNC MLFKQKKNSC YADGDEDYKV EEKLDIEAVV HPREVDPFIL
1321 SLPPSSCMSG LMYKYPSCES VTDEYAGHLI QILKQEGGNS ELIMDQYANR LAYRSVKSGL
1381 QEAAKTTKVQ CNSRMFPVPS SQVKTNKELL MFSNKEHHQE ADKKRQSKRN EGYFCKNQTC
1441 ERTLDPYRNE VSQLYSFSTS LVHSITKDAK EELTASLVGL PKSLTDSCLF EKSGYEEDNE
1501 CHVTPELPKS LQPSSQNHRF YHSTGSLNGY GCGDNVVQAV EQYAKKVVDD TLELTLGSTV
1561 FRVSETTKSA DRVTYAEKLS PLTGQACRYC DLKELHNCTG NSSQHFFRQG SLASSKPASN
1621 PKFSSRYQKS RIFHLSVPQI HVNLDKKAVL AEKIVAEAIE KAERELSSTS LAADSGIGQE
1681 GASFAESLAT ETMTAAVTNV GHAVSSSKEI EDFQSTESVS SQQMNLSIGD DSTGSWSNLS
1741 FEDEHQDESS SFHHLSESNG NSSSWSSLGL EGDLYEDNLS FPTSDSDGPD DKDEEHEDEV
1801 EGLGQDGKTL LITNIDMEPC TVDPQLRIIL QWLIASEAEV AELYFHDSAN KEFMLLSKQL
1861 QEKGWKVGDL LQAVLQYYEV MEKASSEERC KSLFDWLLEN A*

Effects on Restriction sites

Raw variant Created Deleted
1 Cac8I

Experimental services

Genomic description: 224_225delinsGC

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 76 -175 -100
2 77 126 -99 -50
3 127 226 -49 51
4 227 343 52 168
5 344 391 169 216
6 392 526 217 351
7 527 791 352 616
8 792 5292 617 5117
9 5293 5448 5118 5273
10 5449 5532 5274 5357
11 5533 5579 5358 5404
12 5580 5740 5405 5565
13 5741 9920 5566 *4039

CDS information

g. c.
Start 176 1
Stop 5881 5706

Links

Download this reference sequence file: NM_016248.3.gb


Name ID Locus tag Product Link method
AKAP11_v001 NM_016248.3 exhaustion
AKAP11_i001 NP_057332.1 A-kinase anchor protein 11 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.