Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 561

TGTCGTTCTCTTTGATTTTGCTGCC G ACTTCATTGATGGGCCCATCAAAGC
TGTCGTTCTCTTTGATTTTGCTGCC A ACTTCATTGATGGGCCCATCAAAGC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_016180.3:n.561G>A

Affected transcripts - 1

Affected proteins - 1

NM_016180.3(SLC45A2_i001):p.(Asp157Asn)

Reference protein

  1  MGSNSGQAGR HIYKSLADDG PFDSVEPPKR PTSRLIMHSM AMFGREFCYA VEAAYVTPVL
61 LSVGLPSSLY SIVWFLSPIL GFLLQPVVGS ASDHCRSRWG RRRPYILTLG VMMLVGMALY
121 LNGATVVAAL IANPRRKLVW AISVTMIGVV LFDFAADFID GPIKAYLFDV CSHQDKEKGL
181 HYHALFTGFG GALGYLLGAI DWAHLELGRL LGTEFQVMFF FSALVLTLCF TVHLCSISEA
241 PLTEVAKGIP PQQTPQDPPL SSDGMYEYGS IEKVKNGYVN PELAMQGAKN KNHAEQTRRA
301 MTLKSLLRAL VNMPPHYRYL CISHLIGWTA FLSNMLFFTD FMGQIVYRGD PYSAHNSTEF
361 LIYERGVEVG CWGFCINSVF SSLYSYFQKV LVSYIGLKGL YFTGYLLFGL GTGFIGLFPN
421 VYSTLVLCSL FGVMSSTLYT VPFNLITEYH REEEKERQQA PGGDPDNSVR GKGMDCATLT
481 CMVQLAQILV GGGLGFLVNT AGTVVVVVIT ASAVALIGCC FVALFVRYVD *

Protein predicted from variant coding sequence

  1  MGSNSGQAGR HIYKSLADDG PFDSVEPPKR PTSRLIMHSM AMFGREFCYA VEAAYVTPVL
61 LSVGLPSSLY SIVWFLSPIL GFLLQPVVGS ASDHCRSRWG RRRPYILTLG VMMLVGMALY
121 LNGATVVAAL IANPRRKLVW AISVTMIGVV LFDFAANFID GPIKAYLFDV CSHQDKEKGL
181 HYHALFTGFG GALGYLLGAI DWAHLELGRL LGTEFQVMFF FSALVLTLCF TVHLCSISEA
241 PLTEVAKGIP PQQTPQDPPL SSDGMYEYGS IEKVKNGYVN PELAMQGAKN KNHAEQTRRA
301 MTLKSLLRAL VNMPPHYRYL CISHLIGWTA FLSNMLFFTD FMGQIVYRGD PYSAHNSTEF
361 LIYERGVEVG CWGFCINSVF SSLYSYFQKV LVSYIGLKGL YFTGYLLFGL GTGFIGLFPN
421 VYSTLVLCSL FGVMSSTLYT VPFNLITEYH REEEKERQQA PGGDPDNSVR GKGMDCATLT
481 CMVQLAQILV GGGLGFLVNT AGTVVVVVIT ASAVALIGCC FVALFVRYVD *

Effects on Restriction sites

Raw variant Created Deleted
1

Experimental services

Genomic description: 561G>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 477 -92 385
2 478 654 386 562
3 655 980 563 888
4 981 1124 889 1032
5 1125 1248 1033 1156
6 1249 1460 1157 1368
7 1461 1717 1369 *32

CDS information

g. c.
Start 93 1
Stop 1685 1593

Links

Download this reference sequence file: NM_016180.3.gb


Name ID Locus tag Product Link method
SLC45A2_v001 NM_016180.3 exhaustion
SLC45A2_i001 NP_057264.3 membrane-associated transporter protein isoform a exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.