Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 601

CCACCTGCTCCAGCTCTGGCTGGTG G GGCAGCACCGTGAAGACGAATATGA
CCACCTGCTCCAGCTCTGGCTGGTG A GGCAGCACCGTGAAGACGAATATGA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_015849.2:n.601G>A

Affected transcripts - 1

Affected proteins - 1

NM_015849.2(CELA2B_i001):p.(Trp192*)

Reference protein

  1  MIRTLLLSTL VAGALSCGVS TYAPDMSRML GGEEARPNSW PWQVSLQYSS NGQWYHTCGG
61 SLIANSWVLT AAHCISSSGI YRVMLGQHNL YVAESGSLAV SVSKIVVHKD WNSDQVSKGN
121 DIALLKLANP VSLTDKIQLA CLPPAGTILP NNYPCYVTGW GRLQTNGALP DDLKQGRLLV
181 VDYATCSSSG WWGSTVKTNM ICAGGDGVIC TCNGDSGGPL NCQASDGRWE VHGIGSLTSV
241 LGCNYYYKPS IFTRVSNYND WINSVIANN*

Protein predicted from variant coding sequence

  1  MIRTLLLSTL VAGALSCGVS TYAPDMSRML GGEEARPNSW PWQVSLQYSS NGQWYHTCGG
61 SLIANSWVLT AAHCISSSGI YRVMLGQHNL YVAESGSLAV SVSKIVVHKD WNSDQVSKGN
121 DIALLKLANP VSLTDKIQLA CLPPAGTILP NNYPCYVTGW GRLQTNGALP DDLKQGRLLV
181 VDYATCSSSG W*

Effects on Restriction sites

Raw variant Created Deleted
1 HphI, MnlI

Experimental services

Genomic description: 601G>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 65 -25 40
2 66 154 41 129
3 155 252 130 227
4 253 381 228 356
5 382 518 357 493
6 519 664 494 639
7 665 817 640 792
8 818 923 793 *88

CDS information

g. c.
Start 26 1
Stop 835 810

Links

Download this reference sequence file: NM_015849.2.gb


Name ID Locus tag Product Link method
CELA2B_v001 NM_015849.2 exhaustion
CELA2B_i001 NP_056933.2 chymotrypsin-like elastase family member 2B preproprotein exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.