Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 502

AGACAAGATGCACGACAAGGTGTTT G CATACATCGCCCAGAGCCAGCACAA
AGACAAGATGCACGACAAGGTGTTT C CATACATCGCCCAGAGCCAGCACAA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_015627.2:n.502G>C

Affected transcripts - 1

Affected proteins - 1

NM_015627.2(LDLRAP1_i001):p.(Ala130Pro)

Reference protein

  1  MDALKSAGRA LIRSPSLAKQ SWGGGGRHRK LPENWTDTRE TLLEGMLFSL KYLGMTLVEQ
61 PKGEELSAAA IKRIVATAKA SGKKLQKVTL KVSPRGIILT DNLTNQLIEN VSIYRISYCT
121 ADKMHDKVFA YIAQSQHNQS LECHAFLCTK RKMAQAVTLT VAQAFKVAFE FWQVSKEEKE
181 KRDKASQEGG DVLGARQDCT PSLKSLVATG NLLDLEETAK APLSTVSANT TNMDEVPRPQ
241 ALSGSSVVWE LDDGLDEAFS RLAQSRTNPQ VLDTGLTAQD MHYAQCLSPV DWDKPDSSGT
301 EQDDLFSF*

Protein predicted from variant coding sequence

  1  MDALKSAGRA LIRSPSLAKQ SWGGGGRHRK LPENWTDTRE TLLEGMLFSL KYLGMTLVEQ
61 PKGEELSAAA IKRIVATAKA SGKKLQKVTL KVSPRGIILT DNLTNQLIEN VSIYRISYCT
121 ADKMHDKVFP YIAQSQHNQS LECHAFLCTK RKMAQAVTLT VAQAFKVAFE FWQVSKEEKE
181 KRDKASQEGG DVLGARQDCT PSLKSLVATG NLLDLEETAK APLSTVSANT TNMDEVPRPQ
241 ALSGSSVVWE LDDGLDEAFS RLAQSRTNPQ VLDTGLTAQD MHYAQCLSPV DWDKPDSSGT
301 EQDDLFSF*

Effects on Restriction sites

Raw variant Created Deleted
1 MwoI

Experimental services

Genomic description: 502G>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 202 -114 88
2 203 345 89 231
3 346 458 232 344
4 459 573 345 459
5 574 646 460 532
6 647 730 533 616
7 731 861 617 747
8 862 896 748 782
9 897 2935 783 *1894

CDS information

g. c.
Start 115 1
Stop 1041 927

Links

Download this reference sequence file: NM_015627.2.gb


Name ID Locus tag Product Link method
LDLRAP1_v001 NM_015627.2 exhaustion
LDLRAP1_i001 NP_056442.2 low density lipoprotein receptor adapter protein 1 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.