Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 92

ACCACCTTCTGCGCGTTGCTGCCCC G AATGCCGCAGTGGAAGTTCGCGGCC
ACCACCTTCTGCGCGTTGCTGCCCC C AATGCCGCAGTGGAAGTTCGCGGCC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_012435.2:n.92G>C

Affected transcripts - 1

Affected proteins - 1

NM_012435.2(SHC2_i001):p.(Arg31Pro)

Reference protein

  1  MTQGPGGRAP PAPPAPPEPE APTTFCALLP RMPQWKFAAP GGFLGRGPAA ARAAGASGGA
61 DPQPEPAGPG GVPALAAAVL GACEPRCAAP CPLPALSRCR GAGSRGSRGG RGAAGSGDAA
121 AAAEWIRKGS FIHKPAHGWL HPDARVLGPG VSYVVRYMGC IEVLRSMRSL DFNTRTQVTR
181 EAINRLHEAV PGVRGSWKKK APNKALASVL GKSNLRFAGM SISIHISTDG LSLSVPATRQ
241 VIANHHMPSI SFASGGDTDM TDYVAYVAKD PINQRACHIL ECCEGLAQSI ISTVGQAFEL
301 RFKQYLHSPP KVALPPERLA GPEESAWGDE EDSLEHNYYN SIPGKEPPLG GLVDSRLALT
361 QPCALTALDQ GPSPSLRDAC SLPWDVGSTG TAPPGDGYVQ ADARGPPDHE EHLYVNTQGL
421 DAPEPEDSPK KDLFDMRPFE DALKLHECSV AAGVTAAPLP LEDQWPSPPT RRAPVAPTEE
481 QLRQEPWYHG RMSRRAAERM LRADGDFLVR DSVTNPGQYV LTGMHAGQPK HLLLVDPEGV
541 VRTKDVLFES ISHLIDHHLQ NGQPIVAAES ELHLRGVVSR EP*

Protein predicted from variant coding sequence

  1  MTQGPGGRAP PAPPAPPEPE APTTFCALLP PMPQWKFAAP GGFLGRGPAA ARAAGASGGA
61 DPQPEPAGPG GVPALAAAVL GACEPRCAAP CPLPALSRCR GAGSRGSRGG RGAAGSGDAA
121 AAAEWIRKGS FIHKPAHGWL HPDARVLGPG VSYVVRYMGC IEVLRSMRSL DFNTRTQVTR
181 EAINRLHEAV PGVRGSWKKK APNKALASVL GKSNLRFAGM SISIHISTDG LSLSVPATRQ
241 VIANHHMPSI SFASGGDTDM TDYVAYVAKD PINQRACHIL ECCEGLAQSI ISTVGQAFEL
301 RFKQYLHSPP KVALPPERLA GPEESAWGDE EDSLEHNYYN SIPGKEPPLG GLVDSRLALT
361 QPCALTALDQ GPSPSLRDAC SLPWDVGSTG TAPPGDGYVQ ADARGPPDHE EHLYVNTQGL
421 DAPEPEDSPK KDLFDMRPFE DALKLHECSV AAGVTAAPLP LEDQWPSPPT RRAPVAPTEE
481 QLRQEPWYHG RMSRRAAERM LRADGDFLVR DSVTNPGQYV LTGMHAGQPK HLLLVDPEGV
541 VRTKDVLFES ISHLIDHHLQ NGQPIVAAES ELHLRGVVSR EP*

Effects on Restriction sites

Raw variant Created Deleted
1 XcmI BsmI

Experimental services

Genomic description: 92G>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 468 1 468
2 469 539 469 539
3 540 600 540 600
4 601 720 601 720
5 721 774 721 774
6 775 826 775 826
7 827 953 827 953
8 954 1110 954 1110
9 1111 1174 1111 1174
10 1175 1309 1175 1309
11 1310 1620 1310 1620
12 1621 1754 1621 *5
13 1755 2494 *6 *745

CDS information

g. c.
Start 1 1
Stop 1749 1749

Links

Download this reference sequence file: NM_012435.2.gb


Name ID Locus tag Product Link method
SHC2_v001 NM_012435.2 exhaustion
SHC2_i001 NP_036567.2 SHC-transforming protein 2 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.