Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 995

AGCACCCTTGTTTCCCAGCAGCTCT G GGGTCTAGCCCAGCAGCTGGTGGAC
AGCACCCTTGTTTCCCAGCAGCTCT A GGGTCTAGCCCAGCAGCTGGTGGAC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_012222.2:n.995G>A

Affected transcripts - 1

Affected proteins - 1

NM_012222.2(MUTYH_i001):p.(Trp260*)

Reference protein

  1  MTPLVSRLSR LWAIMRKPRA AVGSGHRKQA ASQEGRQKHA KNNSQAKPSA CDGMIAECPG
61 APAGLARQPE EVVLQASVSS YHLFRDVAEV TAFRGSLLSW YDQEKRDLPW RRRAEDEMDL
121 DRRAYAVWVS EVMLQQTQVA TVINYYTGWM QKWPTLQDLA SASLEEVNQL WAGLGYYSRG
181 RRLQEGARKV VEELGGHMPR TAETLQQLLP GVGRYTAGAI ASIAFGQATG VVDGNVARVL
241 CRVRAIGADP SSTLVSQQLW GLAQQLVDPA RPGDFNQAAM ELGATVCTPQ RPLCSQCPVE
301 SLCRARQRVE QEQLLASGSL SGSPDVEECA PNTGQCHLCL PPSEPWDQTL GVVNFPRKAS
361 RKPPREESSA TCVLEQPGAL GAQILLVQRP NSGLLAGLWE FPSVTWEPSE QLQRKALLQE
421 LQRWAGPLPA THLRHLGEVV HTFSHIKLTY QVYGLALEGQ TPVTTVPPGA RWLTQEEFHT
481 AAVSTAMKKV FRVYQGQQPG TCMGSKRSQV SSPCSRKKPR MGQQVLDNFF RSHISTDAHS
541 LNSAAQ*

Protein predicted from variant coding sequence

  1  MTPLVSRLSR LWAIMRKPRA AVGSGHRKQA ASQEGRQKHA KNNSQAKPSA CDGMIAECPG
61 APAGLARQPE EVVLQASVSS YHLFRDVAEV TAFRGSLLSW YDQEKRDLPW RRRAEDEMDL
121 DRRAYAVWVS EVMLQQTQVA TVINYYTGWM QKWPTLQDLA SASLEEVNQL WAGLGYYSRG
181 RRLQEGARKV VEELGGHMPR TAETLQQLLP GVGRYTAGAI ASIAFGQATG VVDGNVARVL
241 CRVRAIGADP SSTLVSQQL*

Effects on Restriction sites

Raw variant Created Deleted
1

Experimental services

Genomic description: 995G>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 252 -216 36
2 253 373 37 157
3 374 555 158 339
4 556 595 340 379
5 596 669 380 453
6 670 711 454 495
7 712 783 496 567
8 784 897 568 681
9 898 995 682 779
10 996 1140 780 924
11 1141 1204 925 988
12 1205 1393 989 1177
13 1394 1530 1178 1314
14 1531 1683 1315 1467
15 1684 1725 1468 1509
16 1726 1921 1510 *64

CDS information

g. c.
Start 217 1
Stop 1857 1641

Links

Download this reference sequence file: NM_012222.2.gb


Name ID Locus tag Product Link method
MUTYH_v001 NM_012222.2 exhaustion
MUTYH_i001 NP_036354.1 adenine DNA glycosylase isoform 1 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.