Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


Sequence "CTTGTAG" at position 580_586 was given, however, the HGVS notation prescribes that on the forward strand it should be "TGTAGCT" at position 582_588.

0 Errors, 1 Warning.


Overview of the raw variants

Raw variant 1: deletion of 580 to 586

TCTCCGGTCTTCTGACCCAGACTAC CTTGTAG CTGTGGATAAATGGCTGGCAGTCCT
TCTCCGGTCTTCTGACCCAGACTAC ------- CTGTGGATAAATGGCTGGCAGTCCT

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_009752.2:n.582_588del

Affected transcripts - 1

Affected proteins - 1

NM_009752.2(Glb1_i001):p.(Val157Trpfs*12)

Reference protein

  1  MLRVPLCTPL PLLALLQLLG AAHGIYNVTQ RTFKLDYSRD RFLKDGQPFR YISGSIHYFR
61 IPRFYWEDRL LKMKMAGLNA IQMYVPWNFH EPQPGQYEFS GDRDVEHFIQ LAHELGLLVI
121 LRPGPYICAE WDMGGLPAWL LEKQSIVLRS SDPDYLVAVD KWLAVLLPKM KPLLYQNGGP
181 IITVQVENEY GSYFACDYDY LRFLVHRFRY HLGNDVILFT TDGASEKMLK CGTLQDLYAT
241 VDFGTGNNIT QAFLVQRKFE PKGPLINSEF YTGWLDHWGK PHSTVKTKTL ATSLYNLLAR
301 GANVNLYMFI GGTNFAYWNG ANTPYEPQPT SYDYDAPLSE AGDLTKKYFA LREVIQMFKE
361 VPEGPIPPST PKFAYGKVAL RKFKTVAEAL GILCPNGPVK SLYPLTFTQV KQYFGYVLYR
421 TTLPQDCSNP KPIFSSPFNG VRDRAYVSVD GVPQGILDRN LMTALNIRGK AGATLDILVE
481 NMGRVNYGRF INDFKGLISN MTINSTVLTN WTVFPLNTEA MVRNHLWGRE ASDEGHLDGR
541 STSNSSDLIL PTFYVGNFSI PSGIPDLPQD TFIQFPGWSK GQVWINGFNL GRYWPTMGPQ
601 KTLFVPRNIL TTSAPNNITV LELEFAPCSE GTPELCTVEF VDTPVIS*

Protein predicted from variant coding sequence

  1  MLRVPLCTPL PLLALLQLLG AAHGIYNVTQ RTFKLDYSRD RFLKDGQPFR YISGSIHYFR
61 IPRFYWEDRL LKMKMAGLNA IQMYVPWNFH EPQPGQYEFS GDRDVEHFIQ LAHELGLLVI
121 LRPGPYICAE WDMGGLPAWL LEKQSIVLRS SDPDYLWING WQSFCPR*

Effects on Restriction sites

Raw variant Created Deleted
1 XcmI AluI

Experimental services

Genomic description: 582_588del

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 192 -114 78
2 193 362 79 248
3 363 513 249 399
4 514 574 400 460
5 575 669 461 555
6 670 850 556 736
7 851 909 737 795
8 910 1031 796 917
9 1032 1072 918 958
10 1073 1185 959 1071
11 1186 1260 1072 1146
12 1261 1350 1147 1236
13 1351 1467 1237 1353
14 1468 1599 1354 1485
15 1600 1854 1486 1740
16 1855 2396 1741 *338

CDS information

g. c.
Start 115 1
Stop 2058 1944

Links

Download this reference sequence file: NM_009752.2.gb


Name ID Locus tag Product Link method
Glb1_v001 NM_009752.2 exhaustion
Glb1_i001 NP_033882.1 beta-galactosidase preproprotein exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.