Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 14604

GCCATGGGAGTCAAGACGCTCCGCA C CATCCTTTCATCTGTCACTCACAAT
GCCATGGGAGTCAAGACGCTCCGCA T CATCCTTTCATCTGTCACTCACAAT

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_009109.2:n.14604C>T

Affected transcripts - 1

Affected proteins - 1

NM_009109.2(Ryr1_i001):p.(Thr4823Ile)

Reference protein

   1  MGDGGGEGED EVQFLRTDDE VVLQCSATVL KEQLKLCLAA EGFGNRLCFL EPTSNAQNVP
61 PDLAICCFIL EQSLSVRALQ EMLANTVEAG VESSQGGGHR TLLYGHAILL RHAHSRMYLS
121 CLTTSRSMTD KLAFDVGLQE DATGEACWWT MHPASKQRSE GEKVRVGDDL ILVSVSSERY
181 LHLSTASGEL QVDASFMQTL WNMNPICSGC EEGFVTGGHV LRLFHGHMDE CLTISPSDSD
241 DQRRLVYYEG GPVCTHARSL WRLEPLRISW SGSHLRWGQP LRIRHVTTGR YLGLTEDQGL
301 VVVDASKAHT KATSFCFRIS KEKLDVAPKR DVEGMGPPEI KYGESLCFVQ HVASGLWLTY
361 AAPDPKALRL GVLKKKAMLH QEGHMDDALS LTRCQQEESQ AARMIYSTAG LYNQFIKGLD
421 SFSGKPRGSG PPAGSALPIE GVILSLQDLI GYFEPPSEEL QHEEKQTKLR SLRNRQSLFQ
481 EEGMLSLVLN CIDRLNVYTT AAHFAEFAGE EAAESWKEIV NLLYELLASL IRGNRTNCAL
541 FSTNLDWLVS KLDRLEASSG ILEVLYCVLI ESPEVLNIIQ ENHIKSIISL LDKHGRNHKV
601 LDVLCSLCVC NGVAVRSNQD LITENLLPGR ELLLQTNLIN YVTSIRPNIF VGRAEGSTQY
661 GKWYFEVMVD EVAPFLTAQA THLRVGWALS EGYSPYPGGG EGWGGNGVGD DLYSYGFDGL
721 HLWTGHVARP VTSPGQHLLA PEDVVSCCLD LSVPSISFRI NGCPVQGVFE SFNLDGLFFP
781 VVSFSAGIKV RFLLGGRHGE FKFLPPPGYA PCHEAVLPRE RLHLQPIKEY RREGPRGPHL
841 VGPSRCLSHL DFVPCPVDTI QIVLPPHLER IREKLAENIH ELWALTRIEQ GWTYGPVRDD
901 NKRLHPCLVN FHSLPEPERN YNLQMSGETL KTLLALGCHV GMADEKAEDN LKKTKLPKTY
961 MMSNGYKPAP LDLSHVRLTP AQTTLVDRLA ENGHNVWARD RVAQGWSYSA VQDIPARRNP
1021 RLVPYRLLDE ATKRSNRDSL CQAVRTLLGY GYNIEPPDQE PSQVDSQSRG DRARIFRAEK
1081 SYAVQSGRWY FEFEAVTTGE MRVGWARPEL RPDVELGADD LAYVFNGHRG QRWHLGSEPF
1141 GRPWQSGDVV GCMIDLTENT IIFTLNGEVL MSDSGSETAF RDIEIGDGFL PVCSLGPGQV
1201 GHLNLGQDVS SLRFFAICGL QEGFEPFAIN MQRPVTTWFS KSLPQFEPVP LEHPHYEVAR
1261 MDGTVDTPPC LRLTHRTWGS QNSLVEMLFL RLSLPVQFHQ HFRCTAGATP LASPGLQPPA
1321 EDEARAAEPD TDYENLRRSA GGWGEAEGGK DGTAKEGTPG GTAQAGVEAQ PARAENEKDA
1381 TTEKNKKRGF LFKAKKVAMM TQPPSTPALP RLPRDVVPAD NRDDPEIILN TTTYYYSVRV
1441 FAGQEPSCVW VGWVTPDYHQ HDMSFDLSKV RAVTVTMGDE QGNVHSSLKC SNCYMVWGGD
1501 FVSPGQQGRI SHTDLVIGCL VDLATGLMTF TANGKESNTF FQVEPNTKLF PAVFVLPTHQ
1561 NVVQFELGKQ KNIMPLSAAM FLSERKNPAP QCPPRLEVQM LMPVSWSRMP NHFLQVDTRR
1621 AGERLGWAVQ CQEPLMMMAL HIPEENRCMD ILELSERLDL QRFHSHTLSL YRSVCALGNN
1681 RVAHALCSHV DQAQLLHALE DARLPGPLRA GYYDLLISIH LESACRSRRS MLSEYIVPLT
1741 PETRAITLFP PGRSAEDGPR RHGLPGVGVT TSLRPPHHFS PPCFVVALPA AGATEAPARL
1801 SPAIPLEALR DKALRMLGEA VRDGGQHARD PVGGSVEFQF VPVLKLVSTL LVMGVFSDED
1861 VKQILKMIEP EVFREEEEVE EEGEEEEEDE EEKEEDEEEE AHEKEDEEKE EAEDAAEEEK
1921 EELEEGLLQM KLPESVKLQM CHLLEYFCDQ ELQHRVESLA AFAECYVDKM QGNQRGRYGL
1981 LMKAFTMSAA ETARRTREFR SPPQEQINML LHFKNGADEE ECPLPEEIRQ ELVNFHQDLL
2041 AHCGIQLEGE EEEPEEESTL GSRLMSLLEK VKLVKKTEEK PEEEPAPEEH KPQSLQELVS
2101 HTVVRWAQED FVQSPELVRA MFSLLHRQYD GLGELLRALP RAYTISVSSV EDTMSLLECL
2161 GQIRSLLIVQ MGPQEENLMI QSIGNIMNNK VFYQHPNLMR ALGMHETVME VMVNVLGGGE
2221 SKEIRFPKMV TSCCRFLCYF CRISRQNQRS MFDHLSYLLE NSGIGLGMQG STPLDVAAAS
2281 VIDNNELALA LQEQDLEKVV SYLAGCGLQS CPMLLAKGYP DIGWNPCGGE RYLDFLRFAV
2341 FVNGESVEEN ANVVVRLLIR KPECFGPALR GEGGSGLLAA IEEAIRISED PARDGPGVRR
2401 DRRREHFGEE PPEENRVHLG HAIMSFYAAL IDLLGRCAPE THLIQAGKGE ALRIRAILRS
2461 LVPLDDLVGI ISLPLQIPTL GKDGALVQPK MSASFVPDHK ASMVLFLDRV YGIENQDFLL
2521 HVLDVGFLPD MRAAASLDTA TFSTTEMALA LNRYLCLAVL PLITKCAPLF AGTEHRAIMV
2581 DSMLHTVYRL SRGRSLTKAQ RDVIEDCLMA LCRYIRPSML QHLLRRLVFD VPILNEFAKM
2641 PLKLLTNHYE RCWKYYCLPT GWANFGVTSE EELHLTRKLF WGIFDSLAHK KYDQELYRIA
2701 MPCLCAIAGA LPPDYVDASY SSKTEKKATV DAEGNFDPRP VETLNVIIPE KLDSFINKFA
2761 EYTHEKWAFD KIQNNWSYGE NIDEELKTHP MLRPYKTFSE KDKEIYRWPI KESLKAMIAW
2821 EWTVEKAREG EEEKTEKKKT RKISQTAQTY DPREGYNPQP PDLSVVTLSR ELQAMAEQLA
2881 ENYHNTWGRK KKQELEAKGG GSHPLLVPYD TLTAKEKARD REKAQELLKF LQMNGYAVTR
2941 GLKDMELDTS SIEKRFAFGF LQQLLRWMDI SQEFIAHLEA VVSSGRVEKS PHEQEIKFFA
3001 KILLPLINQY FTNHCLYFLS TPAKVLGSGG HASNKEKEMI TSLFCKLAAL VRHRVSLFGT
3061 DAPAVVNCLH ILARSLDART VMKSGPEIVK AGLRSFFESA SEDIEKMVEN LRLGKVSQAR
3121 TQVKGVGQNL TYTTVALLPV LTTLFQHIAQ HQFGDDVILD DVQVSCYRTL CSIYSLGTTR
3181 NPYVEKLRPA LGECLARLAA AMPVAFLEPE LNEYNACSVY TTKSPRERAI LGLPNSVEEM
3241 CPDIPVLERL MAEIGGLAES GARYTEMPHV IEITLPMLCS YLPRWWERGP EAPPPALPAG
3301 APPPCTAVTS DHLNSLLGNI LRIIVNNLGI DEASWMKRLA VFAQPIVSRA RPELLRSHFI
3361 PTIGRLRKRA GKVVAEEEQL RLEAKAEAEE GELLVRDEFS VLCRDLYALY PLLIRYVDNN
3421 RAHWLTEPNP NAEELFRMVG EIFIYWSKSH NFKREEQNFV VQNEINNMSF LTADNKSKMA
3481 KAGDVQSGGS DQERTKKKRR GDRYSVQTSL IVATLKKMLP IGLNMCAPTD QDLIVLAKAR
3541 YALKDTDEEV REFLQNNLNL QGKVEGSPSL RWQMALYRGV PGREEDADDP EKIVRRVQEV
3601 SAVLYHLDQT EHPYKSKKAV WHKLLSKQRR RAVVACFRMT PLYNLPTHRA CNMFLESYKA
3661 SWILTEDHSF EDRMIDDLSK AGEQEEEEEE VEEKKPDPLH QLVLHFSRTA LTEKSKLDED
3721 YLYMAYADIM AKSCHLEEGG ENGEEGGEEE EVEVSFEEKE MEKQRLLYQQ SRLHNRGAAE
3781 MVLQMISACK GETGAMVSST LKLGISILNG GNAEVQQKML DYLKDKKEVG FFQSIQALMQ
3841 TCSVLDLNAF ERQNKAEGLG MVNEDGTVIN RQNGEKVMAD DEFTQDLFRF LQLLCEGHNN
3901 DFQNYLRTQT GNTTTINIII CTVDYLLRLQ ESISDFYWYY SGKDVIEEQG KRNFSKAMSV
3961 AKQVFNSLTE YIQGPCTGNQ QSLAHSRLWD AVVGFLHVFA HMMMKLAQDS SQIELLKELL
4021 DLQKDMVVML LSLLEGNVVN GMIARQMVDM LVESSSNVEM ILKFFDMFLK LKDIVGSEAF
4081 QDYVTDPRGL ISKKDFQKAM DSQKQFTGPE IQFLLSCSEA DENEMINCEE FANRFQEPAR
4141 DIGFNVAVLL TNLSEHVPHD PRLRNFLELA ESILEYFRPY LGRIEIMGAS RRIERIYFEI
4201 SETNRAQWEM PQVKESKRQF IFDVVNEGGE SEKMEMFVSF CEDTIFEMQI AAQISEPEGE
4261 PEEDEDEGAE EAEEGAAGSD GSGSAAAAGV WVWLAATAGR TLRGLSYRSL RRRVRRLRRL
4321 TAREAATAVA ALLWALVTRA GGAGAGAAAG ALRLLWGSLF GGGLVDSAKK VTVTELLAGM
4381 PDPTGDEVHG QQPSGAGSDA EGEGEGEGEG DAADGAGDEE AAADQAGTGG ADGAVAVADG
4441 SPFRPEGAGG LGDMGDTTPV EPPTPEGSPI LKRKLGVDGE EEEPPPEPEP EPEPEPEKAD
4501 TENGEKEVPE PPPEPPKKTP PPPPPKKEEA GGAGLEEFWG ELEVQRVKFL NYLSRNFYTL
4561 RFLALFLAFA INFILLFYKV SDSPPGEDDI EGSGAGDMSG AGSGDGSGWG SRAGEEVEGD
4621 EDENMVYYFL EESTGYMEPA LRCLSLLHTL VAFLCIIGYN CLKVPLVIFK REKELARKLE
4681 FDGLYITEQP EDDDVKGQWD RLVLNTPSFP SNYWDKFVKR KVLDKHGDIF GRERIAELLG
4741 MDLASLEITA HNERKPDPPP GLLTWIMSID VKYQIWKFGV IFTDNSFLYL GWYMVMSLLG
4801 HYNNFFFAAH LLDIAMGVKT LRTILSSVTH NGKQLVMTVG LLAVVVYLYT VVAFNFFRKF
4861 YNKSEDEDEP DMKCDDMMTC YLFHMYVGVR AGGGIGDEIE DPAGDEYELY RVVFDITFFF
4921 FVIVILLAII QGLIIDAFGE LRDQQEQVKE DMETKCFICG IGSDYFDTTP HGFETHTLEE
4981 HNLANYMFFL MYLINKDETE HTGQESYVWK MYQERCWDFF PAGDCFRKQY EDQLS*

Protein predicted from variant coding sequence

   1  MGDGGGEGED EVQFLRTDDE VVLQCSATVL KEQLKLCLAA EGFGNRLCFL EPTSNAQNVP
61 PDLAICCFIL EQSLSVRALQ EMLANTVEAG VESSQGGGHR TLLYGHAILL RHAHSRMYLS
121 CLTTSRSMTD KLAFDVGLQE DATGEACWWT MHPASKQRSE GEKVRVGDDL ILVSVSSERY
181 LHLSTASGEL QVDASFMQTL WNMNPICSGC EEGFVTGGHV LRLFHGHMDE CLTISPSDSD
241 DQRRLVYYEG GPVCTHARSL WRLEPLRISW SGSHLRWGQP LRIRHVTTGR YLGLTEDQGL
301 VVVDASKAHT KATSFCFRIS KEKLDVAPKR DVEGMGPPEI KYGESLCFVQ HVASGLWLTY
361 AAPDPKALRL GVLKKKAMLH QEGHMDDALS LTRCQQEESQ AARMIYSTAG LYNQFIKGLD
421 SFSGKPRGSG PPAGSALPIE GVILSLQDLI GYFEPPSEEL QHEEKQTKLR SLRNRQSLFQ
481 EEGMLSLVLN CIDRLNVYTT AAHFAEFAGE EAAESWKEIV NLLYELLASL IRGNRTNCAL
541 FSTNLDWLVS KLDRLEASSG ILEVLYCVLI ESPEVLNIIQ ENHIKSIISL LDKHGRNHKV
601 LDVLCSLCVC NGVAVRSNQD LITENLLPGR ELLLQTNLIN YVTSIRPNIF VGRAEGSTQY
661 GKWYFEVMVD EVAPFLTAQA THLRVGWALS EGYSPYPGGG EGWGGNGVGD DLYSYGFDGL
721 HLWTGHVARP VTSPGQHLLA PEDVVSCCLD LSVPSISFRI NGCPVQGVFE SFNLDGLFFP
781 VVSFSAGIKV RFLLGGRHGE FKFLPPPGYA PCHEAVLPRE RLHLQPIKEY RREGPRGPHL
841 VGPSRCLSHL DFVPCPVDTI QIVLPPHLER IREKLAENIH ELWALTRIEQ GWTYGPVRDD
901 NKRLHPCLVN FHSLPEPERN YNLQMSGETL KTLLALGCHV GMADEKAEDN LKKTKLPKTY
961 MMSNGYKPAP LDLSHVRLTP AQTTLVDRLA ENGHNVWARD RVAQGWSYSA VQDIPARRNP
1021 RLVPYRLLDE ATKRSNRDSL CQAVRTLLGY GYNIEPPDQE PSQVDSQSRG DRARIFRAEK
1081 SYAVQSGRWY FEFEAVTTGE MRVGWARPEL RPDVELGADD LAYVFNGHRG QRWHLGSEPF
1141 GRPWQSGDVV GCMIDLTENT IIFTLNGEVL MSDSGSETAF RDIEIGDGFL PVCSLGPGQV
1201 GHLNLGQDVS SLRFFAICGL QEGFEPFAIN MQRPVTTWFS KSLPQFEPVP LEHPHYEVAR
1261 MDGTVDTPPC LRLTHRTWGS QNSLVEMLFL RLSLPVQFHQ HFRCTAGATP LASPGLQPPA
1321 EDEARAAEPD TDYENLRRSA GGWGEAEGGK DGTAKEGTPG GTAQAGVEAQ PARAENEKDA
1381 TTEKNKKRGF LFKAKKVAMM TQPPSTPALP RLPRDVVPAD NRDDPEIILN TTTYYYSVRV
1441 FAGQEPSCVW VGWVTPDYHQ HDMSFDLSKV RAVTVTMGDE QGNVHSSLKC SNCYMVWGGD
1501 FVSPGQQGRI SHTDLVIGCL VDLATGLMTF TANGKESNTF FQVEPNTKLF PAVFVLPTHQ
1561 NVVQFELGKQ KNIMPLSAAM FLSERKNPAP QCPPRLEVQM LMPVSWSRMP NHFLQVDTRR
1621 AGERLGWAVQ CQEPLMMMAL HIPEENRCMD ILELSERLDL QRFHSHTLSL YRSVCALGNN
1681 RVAHALCSHV DQAQLLHALE DARLPGPLRA GYYDLLISIH LESACRSRRS MLSEYIVPLT
1741 PETRAITLFP PGRSAEDGPR RHGLPGVGVT TSLRPPHHFS PPCFVVALPA AGATEAPARL
1801 SPAIPLEALR DKALRMLGEA VRDGGQHARD PVGGSVEFQF VPVLKLVSTL LVMGVFSDED
1861 VKQILKMIEP EVFREEEEVE EEGEEEEEDE EEKEEDEEEE AHEKEDEEKE EAEDAAEEEK
1921 EELEEGLLQM KLPESVKLQM CHLLEYFCDQ ELQHRVESLA AFAECYVDKM QGNQRGRYGL
1981 LMKAFTMSAA ETARRTREFR SPPQEQINML LHFKNGADEE ECPLPEEIRQ ELVNFHQDLL
2041 AHCGIQLEGE EEEPEEESTL GSRLMSLLEK VKLVKKTEEK PEEEPAPEEH KPQSLQELVS
2101 HTVVRWAQED FVQSPELVRA MFSLLHRQYD GLGELLRALP RAYTISVSSV EDTMSLLECL
2161 GQIRSLLIVQ MGPQEENLMI QSIGNIMNNK VFYQHPNLMR ALGMHETVME VMVNVLGGGE
2221 SKEIRFPKMV TSCCRFLCYF CRISRQNQRS MFDHLSYLLE NSGIGLGMQG STPLDVAAAS
2281 VIDNNELALA LQEQDLEKVV SYLAGCGLQS CPMLLAKGYP DIGWNPCGGE RYLDFLRFAV
2341 FVNGESVEEN ANVVVRLLIR KPECFGPALR GEGGSGLLAA IEEAIRISED PARDGPGVRR
2401 DRRREHFGEE PPEENRVHLG HAIMSFYAAL IDLLGRCAPE THLIQAGKGE ALRIRAILRS
2461 LVPLDDLVGI ISLPLQIPTL GKDGALVQPK MSASFVPDHK ASMVLFLDRV YGIENQDFLL
2521 HVLDVGFLPD MRAAASLDTA TFSTTEMALA LNRYLCLAVL PLITKCAPLF AGTEHRAIMV
2581 DSMLHTVYRL SRGRSLTKAQ RDVIEDCLMA LCRYIRPSML QHLLRRLVFD VPILNEFAKM
2641 PLKLLTNHYE RCWKYYCLPT GWANFGVTSE EELHLTRKLF WGIFDSLAHK KYDQELYRIA
2701 MPCLCAIAGA LPPDYVDASY SSKTEKKATV DAEGNFDPRP VETLNVIIPE KLDSFINKFA
2761 EYTHEKWAFD KIQNNWSYGE NIDEELKTHP MLRPYKTFSE KDKEIYRWPI KESLKAMIAW
2821 EWTVEKAREG EEEKTEKKKT RKISQTAQTY DPREGYNPQP PDLSVVTLSR ELQAMAEQLA
2881 ENYHNTWGRK KKQELEAKGG GSHPLLVPYD TLTAKEKARD REKAQELLKF LQMNGYAVTR
2941 GLKDMELDTS SIEKRFAFGF LQQLLRWMDI SQEFIAHLEA VVSSGRVEKS PHEQEIKFFA
3001 KILLPLINQY FTNHCLYFLS TPAKVLGSGG HASNKEKEMI TSLFCKLAAL VRHRVSLFGT
3061 DAPAVVNCLH ILARSLDART VMKSGPEIVK AGLRSFFESA SEDIEKMVEN LRLGKVSQAR
3121 TQVKGVGQNL TYTTVALLPV LTTLFQHIAQ HQFGDDVILD DVQVSCYRTL CSIYSLGTTR
3181 NPYVEKLRPA LGECLARLAA AMPVAFLEPE LNEYNACSVY TTKSPRERAI LGLPNSVEEM
3241 CPDIPVLERL MAEIGGLAES GARYTEMPHV IEITLPMLCS YLPRWWERGP EAPPPALPAG
3301 APPPCTAVTS DHLNSLLGNI LRIIVNNLGI DEASWMKRLA VFAQPIVSRA RPELLRSHFI
3361 PTIGRLRKRA GKVVAEEEQL RLEAKAEAEE GELLVRDEFS VLCRDLYALY PLLIRYVDNN
3421 RAHWLTEPNP NAEELFRMVG EIFIYWSKSH NFKREEQNFV VQNEINNMSF LTADNKSKMA
3481 KAGDVQSGGS DQERTKKKRR GDRYSVQTSL IVATLKKMLP IGLNMCAPTD QDLIVLAKAR
3541 YALKDTDEEV REFLQNNLNL QGKVEGSPSL RWQMALYRGV PGREEDADDP EKIVRRVQEV
3601 SAVLYHLDQT EHPYKSKKAV WHKLLSKQRR RAVVACFRMT PLYNLPTHRA CNMFLESYKA
3661 SWILTEDHSF EDRMIDDLSK AGEQEEEEEE VEEKKPDPLH QLVLHFSRTA LTEKSKLDED
3721 YLYMAYADIM AKSCHLEEGG ENGEEGGEEE EVEVSFEEKE MEKQRLLYQQ SRLHNRGAAE
3781 MVLQMISACK GETGAMVSST LKLGISILNG GNAEVQQKML DYLKDKKEVG FFQSIQALMQ
3841 TCSVLDLNAF ERQNKAEGLG MVNEDGTVIN RQNGEKVMAD DEFTQDLFRF LQLLCEGHNN
3901 DFQNYLRTQT GNTTTINIII CTVDYLLRLQ ESISDFYWYY SGKDVIEEQG KRNFSKAMSV
3961 AKQVFNSLTE YIQGPCTGNQ QSLAHSRLWD AVVGFLHVFA HMMMKLAQDS SQIELLKELL
4021 DLQKDMVVML LSLLEGNVVN GMIARQMVDM LVESSSNVEM ILKFFDMFLK LKDIVGSEAF
4081 QDYVTDPRGL ISKKDFQKAM DSQKQFTGPE IQFLLSCSEA DENEMINCEE FANRFQEPAR
4141 DIGFNVAVLL TNLSEHVPHD PRLRNFLELA ESILEYFRPY LGRIEIMGAS RRIERIYFEI
4201 SETNRAQWEM PQVKESKRQF IFDVVNEGGE SEKMEMFVSF CEDTIFEMQI AAQISEPEGE
4261 PEEDEDEGAE EAEEGAAGSD GSGSAAAAGV WVWLAATAGR TLRGLSYRSL RRRVRRLRRL
4321 TAREAATAVA ALLWALVTRA GGAGAGAAAG ALRLLWGSLF GGGLVDSAKK VTVTELLAGM
4381 PDPTGDEVHG QQPSGAGSDA EGEGEGEGEG DAADGAGDEE AAADQAGTGG ADGAVAVADG
4441 SPFRPEGAGG LGDMGDTTPV EPPTPEGSPI LKRKLGVDGE EEEPPPEPEP EPEPEPEKAD
4501 TENGEKEVPE PPPEPPKKTP PPPPPKKEEA GGAGLEEFWG ELEVQRVKFL NYLSRNFYTL
4561 RFLALFLAFA INFILLFYKV SDSPPGEDDI EGSGAGDMSG AGSGDGSGWG SRAGEEVEGD
4621 EDENMVYYFL EESTGYMEPA LRCLSLLHTL VAFLCIIGYN CLKVPLVIFK REKELARKLE
4681 FDGLYITEQP EDDDVKGQWD RLVLNTPSFP SNYWDKFVKR KVLDKHGDIF GRERIAELLG
4741 MDLASLEITA HNERKPDPPP GLLTWIMSID VKYQIWKFGV IFTDNSFLYL GWYMVMSLLG
4801 HYNNFFFAAH LLDIAMGVKT LRIILSSVTH NGKQLVMTVG LLAVVVYLYT VVAFNFFRKF
4861 YNKSEDEDEP DMKCDDMMTC YLFHMYVGVR AGGGIGDEIE DPAGDEYELY RVVFDITFFF
4921 FVIVILLAII QGLIIDAFGE LRDQQEQVKE DMETKCFICG IGSDYFDTTP HGFETHTLEE
4981 HNLANYMFFL MYLINKDETE HTGQESYVWK MYQERCWDFF PAGDCFRKQY EDQLS*

Effects on Restriction sites

Raw variant Created Deleted
1 SfaNI BccI

Experimental services

Genomic description: 14604C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 187 -136 51
2 188 307 52 171
3 308 412 172 276
4 413 487 277 351
5 488 566 352 430
6 567 679 431 543
7 680 773 544 637
8 774 867 638 731
9 868 942 732 806
10 943 1099 807 963
11 1100 1264 964 1128
12 1265 1386 1129 1250
13 1387 1582 1251 1446
14 1583 1718 1447 1582
15 1719 1814 1583 1678
16 1815 1933 1679 1797
17 1934 2067 1798 1931
18 2068 2309 1932 2173
19 2310 2502 2174 2366
20 2503 2719 2367 2583
21 2720 2824 2584 2688
22 2825 2928 2689 2792
23 2929 3012 2793 2876
24 3013 3320 2877 3184
25 3321 3523 3185 3387
26 3524 3698 3388 3562
27 3699 3907 3563 3771
28 3908 4302 3772 4166
29 4303 4435 4167 4299
30 4436 4596 4300 4460
31 4597 4762 4461 4626
32 4763 4849 4627 4713
33 4850 5076 4714 4940
34 5077 5689 4941 5553
35 5690 5953 5554 5817
36 5954 6154 5818 6018
37 6155 6266 6019 6130
38 6267 6413 6131 6277
39 6414 6687 6278 6551
40 6688 6802 6552 6666
41 6803 6935 6667 6799
42 6936 7030 6800 6894
43 7031 7166 6895 7030
44 7167 7353 7031 7217
45 7354 7462 7218 7326
46 7463 7583 7327 7447
47 7584 7753 7448 7617
48 7754 7974 7618 7838
49 7975 8065 7839 7929
50 8066 8206 7930 8070
51 8207 8370 8071 8234
52 8371 8449 8235 8313
53 8450 8539 8314 8403
54 8540 8680 8404 8544
55 8681 8755 8545 8619
56 8756 8831 8620 8695
57 8832 8955 8696 8819
58 8956 9071 8820 8935
59 9072 9139 8936 9003
60 9140 9261 9004 9125
61 9262 9311 9126 9175
62 9312 9372 9176 9236
63 9373 9611 9237 9475
64 9612 9693 9476 9557
65 9694 9824 9558 9688
66 9825 10157 9689 10021
67 10158 10398 10022 10262
68 10399 10486 10263 10350
69 10487 10579 10351 10443
70 10580 10594 10444 10458
71 10595 10765 10459 10629
72 10766 10825 10630 10689
73 10826 10963 10690 10827
74 10964 11076 10828 10940
75 11077 11173 10941 11037
76 11174 11280 11038 11144
77 11281 11332 11145 11196
78 11333 11407 11197 11271
79 11408 11507 11272 11371
80 11508 11587 11372 11451
81 11588 11664 11452 11528
82 11665 11738 11529 11602
83 11739 11756 11603 11620
84 11757 11837 11621 11701
85 11838 11926 11702 11790
86 11927 12055 11791 11919
87 12056 12160 11920 12024
88 12161 12242 12025 12106
89 12243 12430 12107 12294
90 12431 12772 12295 12636
91 12773 13564 12637 13428
92 13565 13635 13429 13499
93 13636 13786 13500 13650
94 13787 13873 13651 13737
95 13874 14125 13738 13989
96 14126 14256 13990 14120
97 14257 14299 14121 14163
98 14300 14430 14164 14294
99 14431 14491 14295 14355
100 14492 14638 14356 14502
101 14639 14773 14503 14637
102 14774 14930 14638 14794
103 14931 14995 14795 14859
104 14996 15096 14860 14960
105 15097 15148 14961 15012
106 15149 15362 15013 *118

CDS information

g. c.
Start 137 1
Stop 15244 15108

Links

Download this reference sequence file: NM_009109.2.gb


Name ID Locus tag Product Link method
Ryr1_v001 NM_009109.2 exhaustion
Ryr1_i001 NP_033135.2 ryanodine receptor 1 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.