Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 4345

GTGCAGCTCTTCAAGGGCAAGTTCT T CCACTGCACGGACGAGTCCAAGGAG
GTGCAGCTCTTCAAGGGCAAGTTCT G CCACTGCACGGACGAGTCCAAGGAG

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_007578.3:n.4345T>G

Affected transcripts - 1

Affected proteins - 1

NM_007578.3(Cacna1a_i001):p.(Phe1355Cys)

Reference protein

   1  MARFGDEMPG RYGAGGGGSG PAAGVVVGAA GGRGAGGSRQ GGQPGAQRMY KQSMAQRART
61 MALYNPIPVR QNCLTVNRSL FLFSEDNVVR KYAKKITEWP PFEYMILATI IANCIVLALE
121 QHLPDDDKTP MSERLDDTEP YFIGIFCFEA GIKIVALGFA FHKGSYLRNG WNVMDFVVVL
181 TGILATVGTE FDLRTLRAVR VLRPLKLVSG IPSLQVVLKS IMKAMIPLLQ IGLLLFFAIL
241 IFAIIGLEFY MGKFHTTCFE EGTDDIQGES PAPCGTEEPA RTCPNGTKCQ PYWEGPNNGI
301 TQFDNILFAV LTVFQCITME GWTDLLYNSN DASGNTWNWL YFIPLIIIGS FFMLNLVLGV
361 LSGEFAKERE RVENRRAFLK LRRQQQIERE LNGYMEWISK AEEVILAEDE TDVEQRHPFD
421 GALRRATLKK SKTDLLNPEE AEDQLADIAS VGSPFARASI KSAKLENSTF FHKKERRMRF
481 YIRRMVKTQA FYWTVLSLVA LNTLCVAIVH YNQPEWLSDF LYYAEFIFLG LFMSEMFIKM
541 YGLGTRPYFH SSFNCFDCGV IIGSIFEVIW AVIKPGTSFG ISVLRALRLL RIFKVTKYWA
601 SLRNLVVSLL NSMKSIISLL FLLFLFIVVF ALLGMQLFGG QFNFDEGTPP TNFDTFPAAI
661 MTVFQILTGE DWNEVMYDGI KSQGGVQGGM VFSIYFIVLT LFGNYTLLNV FLAIAVDNLA
721 NAQELTKDEQ EEEEAANQKL ALQKAKEVAE VSPLSAANMS IAVKEQQKNQ KPTKSVWEQR
781 TSEMRKQNLL ASREALYGDA AERWPTPYAR PLRPDVKTHL DRPLVVDPQE NRNNNTNKSR
841 APEALRPTAR PRESARDPDA RRAWPGSPER APGREGPYGR ESEPQQREHA PPREHAPWDA
901 DTERAKAGDA PRRHTHRPVA EGEPRRHRAR RRPGDEPDDR PERRPRPRDA TRPARAADGE
961 GDDGERKRRH RHGPPAHDDR ERRHRRRKEN QGSGVPVSGP NLSTTRPIQQ DLGRQDLPLA
1021 EDLDNMKNNK LATGEPASPH DSLGHSGLPP SPAKIGNSTN PGPALATNPQ NAASRRTPNN
1081 PGNPSNPGPP KTPENSLIVT NPSSTQPNSA KTARKPEHMA VEIPPACPPL NHTVVQVNKN
1141 ANPDPLPKKE EEKKEEEEAD PGEDGPKPMP PYSSMFILST TNPLRRLCHY ILNLRYFEMC
1201 ILMVIAMSSI ALAAEDPVQP NAPRNNVLRY FDYVFTGVFT FEMVIKMIDL GLVLHQGAYF
1261 RDLWNILDFI VVSGALVAFA FTGNSKGKDI NTIKSLRVLR VLRPLKTIKR LPKLKAVFDC
1321 VVNSLKNVFN ILIVYMLFMF IFAVVAVQLF KGKFFHCTDE SKEFERDCRG KYLLYEKNEV
1381 KARDREWKKY EFHYDNVLWA LLTLFTVSTG EGWPQVLKHS VDATFENQGP SPGYRMEMSI
1441 FYVVYFVVFP FFFVNIFVAL IIITFQEQGD KMMEEYSLEK NERACIDFAI SAKPLTRHMP
1501 QNKQSFQYRM WQFVVSPPFE YTIMAMIALN TIVLMMKFYG ASVAYENALR VFNIVFTSLF
1561 SLECVLKVMA FGILNYFRDA WNIFDFVTVL GSITDILVTE FGNNFINLSF LRLFRAARLI
1621 KLLRQGYTIR ILLWTFVQSF KALPYVCLLI AMLFFIYAII GMQVFGNIGI DGEDEDSDED
1681 EFQITEHNNF RTFFQALMLL FRSATGEAWH NIMLSCLSGK PCDKNSGILT ADCGNEFAYF
1741 YFVSFIFLCS FLMLNLFVAV IMDNFEYLTR DSSILGPHHL DEYVRVWAEY DPAACGRIHY
1801 KDMYSLLRVI SPPLGLGKKC PHRVACKRLL RMDLPVADDN TVHFNSTLMA LIRTALDIKI
1861 AKGGADKQQM DAELRKEMMA IWPNLSQKTL DLLVTPHKST DLTVGKIYAA MMIMEYYRQS
1921 KAKKLQAMRE EQNRTPLMFQ RMEPPSPTQE GGPSQNALPS TQLDPGGGLM AHEGGMKESP
1981 SWVTQRAQEM FQKTGTWSPE RGPPIDMPNS QPNSQSVEMR EMGTDGYSDS EHYLPMEGQT
2041 RAASMPRLPA ENQRRRGRPR GNDLSTISDT SPMKRSASVL GPKARRLDDY SLERVPPEEN
2101 QRYHQRRRDR GHRTSERSLG RYTDVDTGLG TDLSMTTQSG DLPSKDRDQD RGRPKDRKHR
2161 PHHHHHHHHH HPPAPDRDRY AQERPDTGRA RAREQRWSRS PSEGREHTTH RQGSSSVSGS
2221 PAPSTSGTST PRRGRRQLPQ TPCTPRPLVS YSPAPRRPAA RRMAGPAAPP GGSPRGCRRA
2281 PRWPAHAPEG PRPRGADYTE PDSPREPPGG AHDPAPRSPR TPRAAGCASP RHGRRLPNGY
2341 YAGHGAPRPR TARRGAHDAY SESEDDWC*

Protein predicted from variant coding sequence

   1  MARFGDEMPG RYGAGGGGSG PAAGVVVGAA GGRGAGGSRQ GGQPGAQRMY KQSMAQRART
61 MALYNPIPVR QNCLTVNRSL FLFSEDNVVR KYAKKITEWP PFEYMILATI IANCIVLALE
121 QHLPDDDKTP MSERLDDTEP YFIGIFCFEA GIKIVALGFA FHKGSYLRNG WNVMDFVVVL
181 TGILATVGTE FDLRTLRAVR VLRPLKLVSG IPSLQVVLKS IMKAMIPLLQ IGLLLFFAIL
241 IFAIIGLEFY MGKFHTTCFE EGTDDIQGES PAPCGTEEPA RTCPNGTKCQ PYWEGPNNGI
301 TQFDNILFAV LTVFQCITME GWTDLLYNSN DASGNTWNWL YFIPLIIIGS FFMLNLVLGV
361 LSGEFAKERE RVENRRAFLK LRRQQQIERE LNGYMEWISK AEEVILAEDE TDVEQRHPFD
421 GALRRATLKK SKTDLLNPEE AEDQLADIAS VGSPFARASI KSAKLENSTF FHKKERRMRF
481 YIRRMVKTQA FYWTVLSLVA LNTLCVAIVH YNQPEWLSDF LYYAEFIFLG LFMSEMFIKM
541 YGLGTRPYFH SSFNCFDCGV IIGSIFEVIW AVIKPGTSFG ISVLRALRLL RIFKVTKYWA
601 SLRNLVVSLL NSMKSIISLL FLLFLFIVVF ALLGMQLFGG QFNFDEGTPP TNFDTFPAAI
661 MTVFQILTGE DWNEVMYDGI KSQGGVQGGM VFSIYFIVLT LFGNYTLLNV FLAIAVDNLA
721 NAQELTKDEQ EEEEAANQKL ALQKAKEVAE VSPLSAANMS IAVKEQQKNQ KPTKSVWEQR
781 TSEMRKQNLL ASREALYGDA AERWPTPYAR PLRPDVKTHL DRPLVVDPQE NRNNNTNKSR
841 APEALRPTAR PRESARDPDA RRAWPGSPER APGREGPYGR ESEPQQREHA PPREHAPWDA
901 DTERAKAGDA PRRHTHRPVA EGEPRRHRAR RRPGDEPDDR PERRPRPRDA TRPARAADGE
961 GDDGERKRRH RHGPPAHDDR ERRHRRRKEN QGSGVPVSGP NLSTTRPIQQ DLGRQDLPLA
1021 EDLDNMKNNK LATGEPASPH DSLGHSGLPP SPAKIGNSTN PGPALATNPQ NAASRRTPNN
1081 PGNPSNPGPP KTPENSLIVT NPSSTQPNSA KTARKPEHMA VEIPPACPPL NHTVVQVNKN
1141 ANPDPLPKKE EEKKEEEEAD PGEDGPKPMP PYSSMFILST TNPLRRLCHY ILNLRYFEMC
1201 ILMVIAMSSI ALAAEDPVQP NAPRNNVLRY FDYVFTGVFT FEMVIKMIDL GLVLHQGAYF
1261 RDLWNILDFI VVSGALVAFA FTGNSKGKDI NTIKSLRVLR VLRPLKTIKR LPKLKAVFDC
1321 VVNSLKNVFN ILIVYMLFMF IFAVVAVQLF KGKFCHCTDE SKEFERDCRG KYLLYEKNEV
1381 KARDREWKKY EFHYDNVLWA LLTLFTVSTG EGWPQVLKHS VDATFENQGP SPGYRMEMSI
1441 FYVVYFVVFP FFFVNIFVAL IIITFQEQGD KMMEEYSLEK NERACIDFAI SAKPLTRHMP
1501 QNKQSFQYRM WQFVVSPPFE YTIMAMIALN TIVLMMKFYG ASVAYENALR VFNIVFTSLF
1561 SLECVLKVMA FGILNYFRDA WNIFDFVTVL GSITDILVTE FGNNFINLSF LRLFRAARLI
1621 KLLRQGYTIR ILLWTFVQSF KALPYVCLLI AMLFFIYAII GMQVFGNIGI DGEDEDSDED
1681 EFQITEHNNF RTFFQALMLL FRSATGEAWH NIMLSCLSGK PCDKNSGILT ADCGNEFAYF
1741 YFVSFIFLCS FLMLNLFVAV IMDNFEYLTR DSSILGPHHL DEYVRVWAEY DPAACGRIHY
1801 KDMYSLLRVI SPPLGLGKKC PHRVACKRLL RMDLPVADDN TVHFNSTLMA LIRTALDIKI
1861 AKGGADKQQM DAELRKEMMA IWPNLSQKTL DLLVTPHKST DLTVGKIYAA MMIMEYYRQS
1921 KAKKLQAMRE EQNRTPLMFQ RMEPPSPTQE GGPSQNALPS TQLDPGGGLM AHEGGMKESP
1981 SWVTQRAQEM FQKTGTWSPE RGPPIDMPNS QPNSQSVEMR EMGTDGYSDS EHYLPMEGQT
2041 RAASMPRLPA ENQRRRGRPR GNDLSTISDT SPMKRSASVL GPKARRLDDY SLERVPPEEN
2101 QRYHQRRRDR GHRTSERSLG RYTDVDTGLG TDLSMTTQSG DLPSKDRDQD RGRPKDRKHR
2161 PHHHHHHHHH HPPAPDRDRY AQERPDTGRA RAREQRWSRS PSEGREHTTH RQGSSSVSGS
2221 PAPSTSGTST PRRGRRQLPQ TPCTPRPLVS YSPAPRRPAA RRMAGPAAPP GGSPRGCRRA
2281 PRWPAHAPEG PRPRGADYTE PDSPREPPGG AHDPAPRSPR TPRAAGCASP RHGRRLPNGY
2341 YAGHGAPRPR TARRGAHDAY SESEDDWC*

Effects on Restriction sites

Raw variant Created Deleted
1 BstAPI, MwoI MboII

Experimental services

Genomic description: 4345T>G

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 580 -281 299
2 581 686 300 405
3 687 826 406 545
4 827 918 546 637
5 919 1071 638 790
6 1072 1265 791 984
7 1266 1369 985 1088
8 1370 1485 1089 1204
9 1486 1542 1205 1261
10 1543 1635 1262 1354
11 1636 1845 1355 1564
12 1846 1958 1565 1677
13 1959 2071 1678 1790
14 2072 2203 1791 1922
15 2204 2276 1923 1995
16 2277 2394 1996 2113
17 2395 2462 2114 2181
18 2463 2569 2182 2288
19 2570 3244 2289 2963
20 3245 3690 2964 3409
21 3691 3829 3410 3548
22 3830 3959 3549 3678
23 3960 4019 3679 3738
24 4020 4126 3739 3845
25 4127 4226 3846 3945
26 4227 4387 3946 4106
27 4388 4525 4107 4244
28 4526 4727 4245 4446
29 4728 4892 4447 4611
30 4893 5003 4612 4722
31 5004 5087 4723 4806
32 5088 5204 4807 4923
33 5205 5270 4924 4989
34 5271 5386 4990 5105
35 5387 5537 5106 5256
36 5538 5665 5257 5384
37 5666 5762 5385 5481
38 5763 5868 5482 5587
39 5869 5976 5588 5695
40 5977 6077 5696 5796
41 6078 6187 5797 5906
42 6188 6326 5907 6045
43 6327 6440 6046 6159
44 6441 6476 6160 6195
45 6477 6663 6196 6382
46 6664 6917 6383 6636
47 6918 7929 6637 *541

CDS information

g. c.
Start 282 1
Stop 7388 7107

Links

Download this reference sequence file: NM_007578.3.gb


Name ID Locus tag Product Link method
Cacna1a_v001 NM_007578.3 exhaustion
Cacna1a_i001 NP_031604.3 voltage-dependent P/Q-type calcium channel subunit alpha-1A isoform 1 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.