Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 838

CGTCTGACGTCGATATAATACGGCA C TGCTTGCGGACTTACGCCACGATTG
CGTCTGACGTCGATATAATACGGCA T TGCTTGCGGACTTACGCCACGATTG

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_007357.2:n.838C>T

Affected transcripts - 1

Affected proteins - 1

NM_007357.2(COG2_i001):p.(=)

Reference protein

  1  MEKSRMNLPK GPDTLCFDKD EFMKEDFDVD HFVSDCRKRV QLEELRDDLE LYYKLLKTAM
61 VELINKDYAD FVNLSTNLVG MDKALNQLSV PLGQLREEVL SLRSSVSEGI RAVDERMSKQ
121 EDIRKKKMCV LRLIQVIRSV EKIEKILNSQ SSKETSALEA SSPLLTGQIL ERIATEFNQL
181 QFHAVQSKGM PLLDKVRPRI AGITAMLQQS LEGLLLEGLQ TSDVDIIRHC LRTYATIDKT
241 RDAEALVGQV LVKPYIDEVI IEQFVESHPN GLQVMYNKLL EFVPHHCRLL REVTGGAISS
301 EKGNTVPGYD FLVNSVWPQI VQGLEEKLPS LFNPGNPDAF HEKYTISMDF VRRLERQCGS
361 QASVKRLRAH PAYHSFNKKW NLPVYFQIRF REIAGSLEAA LTDVLEDAPA ESPYCLLASH
421 RTWSSLRRCW SDEMFLPLLV HRLWRLTLQI LARYSVFVNE LSLRPISNES PKEIKKPLVT
481 GSKEPSITQG NTEDQGSGPS ETKPVVSISR TQLVYVVADL DKLQEQLPEL LEIIKPKLEM
541 IGFKNFSSIS AALEDSQSSF SACVPSLSSK IIQDLSDSCF GFLKSALEVP RLYRRTNKEV
601 PTTASSYVDS ALKPLFQLQS GHKDKLKQAI IQQWLEGTLS ESTHKYYETV SDVLNSVKKM
661 EESLKRLKQA RKTTPANPVG PSGGMSDDDK IRLQLALDVE YLGEQIQKLG LQASDIKSFS
721 ALAELVAAAK DQATAEQP*

Protein predicted from variant coding sequence

No change: predicted protein (not shown) equals reference protein.

Effects on Restriction sites

Raw variant Created Deleted
1 BsrDI BtsI, BtsIMutI, TspRI

Experimental services

Genomic description: 838C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 223 -151 72
2 224 385 73 234
3 386 451 235 300
4 452 532 301 381
5 533 636 382 485
6 637 745 486 594
7 746 925 595 774
8 926 1050 775 899
9 1051 1177 900 1026
10 1178 1317 1027 1166
11 1318 1379 1167 1228
12 1380 1531 1229 1380
13 1532 1729 1381 1578
14 1730 1802 1579 1651
15 1803 1945 1652 1794
16 1946 2085 1795 1934
17 2086 2266 1935 2115
18 2267 2960 2116 *592

CDS information

g. c.
Start 152 1
Stop 2368 2217

Links

Download this reference sequence file: NM_007357.2.gb


Name ID Locus tag Product Link method
COG2_v001 NM_007357.2 exhaustion
COG2_i001 NP_031383.1 conserved oligomeric Golgi complex subunit 2 isoform 1 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.