Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 575

CGACCGCAATGGCAGCTTTGGGGGG C AGTACAGTGAATGCCGAGACCCAGC
CGACCGCAATGGCAGCTTTGGGGGG T AGTACAGTGAATGCCGAGACCCAGC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_005858.3:n.575C>T

Affected transcripts - 1

Affected proteins - 1

NM_005858.3(AKAP8_i001):p.(Gln169*)

Reference protein

  1  MDQGYGGYGA WSAGPANTQG AYGTGVASWQ GYENYNYYGA QNTSVTTGAT YSYGPASWEA
61 AKANDGGLAA GAPAMHMASY GPEPCTDNSD SLIAKINQRL DMMSKEGGRG GSGGGGEGIQ
121 DRESSFRFQP FESYDSRPCL PEHNPYRPSY SYDYEFDLGS DRNGSFGGQY SECRDPARER
181 GSLDGFMRGR GQGRFQDRSN PGTFMRSDPF VPPAASSEPL STPWNELNYV GGRGLGGPSP
241 SRPPPSLFSQ SMAPDYGVMG MQGAGGYDST MPYGCGRSQP RMRDRDRPKR RGFDRFGPDG
301 TGRKRKQFQL YEEPDTKLAR VDSEGDFSEN DDAAGDFRSG DEEFKGEDEL CDSGRQRGEK
361 EDEDEDVKKR REKQRRRDRT RDRAADRIQF ACSVCKFRSF DDEEIQKHLQ SKFHKETLRF
421 ISTKLPDKTV EFLQEYIVNR NKKIEKRRQE LMEKETAKPK PDPFKGIGQE HFFKKIEAAH
481 CLACDMLIPA QPQLLQRHLH SVDHNHNRRL AAEQFKKTSL HVAKSVLNNR HIVKMLEKYL
541 KGEDPFTSET VDPEMEGDDN LGGEDKKETP EEVAADVLAE VITAAVRAVD GEGAPAPESS
601 GEPAEDEGPT DTAEAGSDPQ AEQLLEEQVP CGTAHEKGVP KARSEAAEAG NGAETMAAEA
661 ESAQTRVAPA PAAADAEVEQ TDAESKDAVP TE*

Protein predicted from variant coding sequence

  1  MDQGYGGYGA WSAGPANTQG AYGTGVASWQ GYENYNYYGA QNTSVTTGAT YSYGPASWEA
61 AKANDGGLAA GAPAMHMASY GPEPCTDNSD SLIAKINQRL DMMSKEGGRG GSGGGGEGIQ
121 DRESSFRFQP FESYDSRPCL PEHNPYRPSY SYDYEFDLGS DRNGSFGG*

Effects on Restriction sites

Raw variant Created Deleted
1

Experimental services

Genomic description: 575C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 89 -70 19
2 90 128 20 58
3 129 161 59 91
4 162 441 92 371
5 442 931 372 861
6 932 1061 862 991
7 1062 1108 992 1038
8 1109 1142 1039 1072
9 1143 1230 1073 1160
10 1231 1372 1161 1302
11 1373 1466 1303 1396
12 1467 1597 1397 1527
13 1598 1693 1528 1623
14 1694 3543 1624 *1394

CDS information

g. c.
Start 71 1
Stop 2149 2079

Links

Download this reference sequence file: NM_005858.3.gb


Name ID Locus tag Product Link method
AKAP8_v001 NM_005858.3 exhaustion
AKAP8_i001 NP_005849.1 A-kinase anchor protein 8 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.