Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 12076

CCCTTGCAACTCTCAGACCCGTGCA G TTAATCGGAGGGGAACAGACCCTCT
CCCTTGCAACTCTCAGACCCGTGCA A TTAATCGGAGGGGAACAGACCCTCT

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_004667.5:n.12076G>A

Affected transcripts - 1

Affected proteins - 1

NM_004667.5(HERC2_i001):p.(=)

Reference protein

   1  MPSESFCLAA QARLDSKWLK TDIQLAFTRD GLCGLWNEMV KDGEIVYTGT ESTQNGELPP
61 RKDDSVEPSG TKKEDLNDKE KKDEEETPAP IYRAKSILDS WVWGKQPDVN ELKECLSVLV
121 KEQQALAVQS ATTTLSALRL KQRLVILERY FIALNRTVFQ ENVKVKWKSS GISLPPVDKK
181 SSRPAGKGVE GLARVGSRAA LSFAFAFLRR AWRSGEDADL CSELLQESLD ALRALPEASL
241 FDESTVSSVW LEVVERATRF LRSVVTGDVH GTPATKGPGS IPLQDQHLAL AILLELAVQR
301 GTLSQMLSAI LLLLQLWDSG AQETDNERSA QGTSAPLLPL LQRFQSIICR KDAPHSEGDM
361 HLLSGPLSPN ESFLRYLTLP QDNELAIDLR QTAVVVMAHL DRLATPCMPP LCSSPTSHKG
421 SLQEVIGWGL IGWKYYANVI GPIQCEGLAN LGVTQIACAE KRFLILSRNG RVYTQAYNSD
481 TLAPQLVQGL ASRNIVKIAA HSDGHHYLAL AATGEVYSWG CGDGGRLGHG DTVPLEEPKV
541 ISAFSGKQAG KHVVHIACGS TYSAAITAEG ELYTWGRGNY GRLGHGSSED EAIPMLVAGL
601 KGLKVIDVAC GSGDAQTLAV TENGQVWSWG DGDYGKLGRG GSDGCKTPKL IEKLQDLDVV
661 KVRCGSQFSI ALTKDGQVYS WGKGDNQRLG HGTEEHVRYP KLLEGLQGKK VIDVAAGSTH
721 CLALTEDSEV HSWGSNDQCQ HFDTLRVTKP EPAALPGLDT KHIVGIACGP AQSFAWSSCS
781 EWSIGLRVPF VVDICSMTFE QLDLLLRQVS EGMDGSADWP PPQEKECVAV ATLNLLRLQL
841 HAAISHQVDP EFLGLGLGSI LLNSLKQTVV TLASSAGVLS TVQSAAQAVL QSGWSVLLPT
901 AEERARALSA LLPCAVSGNE VNISPGRRFM IDLLVGSLMA DGGLESALHA AITAEIQDIE
961 AKKEAQKEKE IDEQEANAST FHRSRTPLDK DLINTGICES SGKQCLPLVQ LIQQLLRNIA
1021 SQTVARLKDV ARRISSCLDF EQHSRERSAS LDLLLRFQRL LISKLYPGES IGQTSDISSP
1081 ELMGVGSLLK KYTALLCTHI GDILPVAASI ASTSWRHFAE VAYIVEGDFT GVLLPELVVS
1141 IVLLLSKNAG LMQEAGAVPL LGGLLEHLDR FNHLAPGKER DDHEELAWPG IMESFFTGQN
1201 CRNNEEVTLI RKADLENHNK DGGFWTVIDG KVYDIKDFQT QSLTGNSILA QFAGEDPVVA
1261 LEAALQFEDT RESMHAFCVG QYLEPDQEIV TIPDLGSLSS PLIDTERNLG LLLGLHASYL
1321 AMSTPLSPVE IECAKWLQSS IFSGGLQTSQ IHYSYNEEKD EDHCSSPGGT PASKSRLCSH
1381 RRALGDHSQA FLQAIADNNI QDHNVKDFLC QIERYCRQCH LTTPIMFPPE HPVEEVGRLL
1441 LCCLLKHEDL GHVALSLVHA GALGIEQVKH RTLPKSVVDV CRVVYQAKCS LIKTHQEQGR
1501 SYKEVCAPVI ERLRFLFNEL RPAVCNDLSI MSKFKLLSSL PRWRRIAQKI IRERRKKRVP
1561 KKPESTDDEE KIGNEESDLE EACILPHSPI NVDKRPIAIK SPKDKWQPLL STVTGVHKYK
1621 WLKQNVQGLY PQSPLLSTIA EFALKEEPVD VEKMRKCLLK QLERAEVRLE GIDTILKLAS
1681 KNFLLPSVQY AMFCGWQRLI PEGIDIGEPL TDCLKDVDLI PPFNRMLLEV TFGKLYAWAV
1741 QNIRNVLMDA SAKFKELGIQ PVPLQTITNE NPSGPSLGTI PQARFLLVML SMLTLQHGAN
1801 NLDLLLNSGM LALTQTALRL IGPSCDNVEE DMNASAQGAS ATVLEETRKE TAPVQLPVSG
1861 PELAAMMKIG TRVMRGVDWK WGDQDGPPPG LGRVIGELGE DGWIRVQWDT GSTNSYRMGK
1921 EGKYDLKLAE LPAAAQPSAE DSDTEDDSEA EQTERNIHPT AMMFTSTINL LQTLCLSAGV
1981 HAEIMQSEAT KTLCGLLRML VESGTTDKTS SPNRLVYREQ HRSWCTLGFV RSIALTPQVC
2041 GALSSPQWIT LLMKVVEGHA PFTATSLQRQ ILAVHLLQAV LPSWDKTERA RDMKCLVEKL
2101 FDFLGSLLTT CSSDVPLLRE STLRRRRVRP QASLTATHSS TLAEEVVALL RTLHSLTQWN
2161 GLINKYINSQ LRSITHSFVG RPSEGAQLED YFPDSENPEV GGLMAVLAVI GGIDGRLRLG
2221 GQVMHDEFGE GTVTRITPKG KITVQFSDMR TCRVCPLNQL KPLPAVAFNV NNLPFTEPML
2281 SVWAQLVNLA GSKLEKHKIK KSTKQAFAGQ VDLDLLRCQQ LKLYILKAGR ALLSHQDKLR
2341 QILSQPAVQE TGTVHTDDGA VVSPDLGDMS PEGPQPPMIL LQQLLASATQ PSPVKAIFDK
2401 QELEAAALAV CQCLAVESTH PSSPGFEDCS SSEATTPVAV QHIRPARVKR RKQSPVPALP
2461 IVVQLMEMGF SRRNIEFALK SLTGASGNAS SLPGVEALVG WLLDHSDIQV TELSDADTVS
2521 DEYSDEEVVE DVDDAAYSMS TGAVVTESQT YKKRADFLSN DDYAVYVREN IQVGMMVRCC
2581 RAYEEVCEGD VGKVIKLDRD GLHDLNVQCD WQQKGGTYWV RYIHVELIGY PPPSSSSHIK
2641 IGDKVRVKAS VTTPKYKWGS VTHQSVGVVK AFSANGKDII VDFPQQSHWT GLLSEMELVP
2701 SIHPGVTCDG CQMFPINGSR FKCRNCDDFD FCETCFKTKK HNTRHTFGRI NEPGQSAVFC
2761 GRSGKQLKRC HSSQPGMLLD SWSRMVKSLN VSSSVNQASR LIDGSEPCWQ SSGSQGKHWI
2821 RLEIFPDVLV HRLKMIVDPA DSSYMPSLVV VSGGNSLNNL IELKTININP SDTTVPLLND
2881 CTEYHRYIEI AIKQCRSSGI DCKIHGLILL GRIRAEEEDL AAVPFLASDN EEEEDEKGNS
2941 GSLIRKKAAG LESAATIRTK VFVWGLNDKD QLGGLKGSKI KVPSFSETLS ALNVVQVAGG
3001 SKSLFAVTVE GKVYACGEAT NGRLGLGISS GTVPIPRQIT ALSSYVVKKV AVHSGGRHAT
3061 ALTVDGKVFS WGEGDDGKLG HFSRMNCDKP RLIEALKTKR IRDIACGSSH SAALTSSGEL
3121 YTWGLGEYGR LGHGDNTTQL KPKMVKVLLG HRVIQVACGS RDAQTLALTD EGLVFSWGDG
3181 DFGKLGRGGS EGCNIPQNIE RLNGQGVCQI ECGAQFSLAL TKSGVVWTWG KGDYFRLGHG
3241 SDVHVRKPQV VEGLRGKKIV HVAVGALHCL AVTDSGQVYA WGDNDHGQQG NGTTTVNRKP
3301 TLVQGLEGQK ITRVACGSSH SVAWTTVDVA TPSVHEPVLF QTARDPLGAS YLGVPSDADS
3361 SAASNKISGA SNSKPNRPSL AKILLSLDGN LAKQQALSHI LTALQIMYAR DAVVGALMPA
3421 AMIAPVECPS FSSAAPSDAS AMASPMNGEE CMLAVDIEDR LSPNPWQEKR EIVSSEDAVT
3481 PSAVTPSAPS ASARPFIPVT DDLGAASIIA ETMTKTKEDV ESQNKAAGPE PQALDEFTSL
3541 LIADDTRVVV DLLKLSVCSR AGDRGRDVLS AVLSGMGTAY PQVADMLLEL CVTELEDVAT
3601 DSQSGRLSSQ PVVVESSHPY TDDTSTSGTV KIPGAEGLRV EFDRQCSTER RHDPLTVMDG
3661 VNRIVSVRSG REWSDWSSEL RIPGDELKWK FISDGSVNGW GWRFTVYPIM PAAGPKELLS
3721 DRCVLSCPSM DLVTCLLDFR LNLASNRSIV PRLAASLAAC AQLSALAASH RMWALQRLRK
3781 LLTTEFGQSI NINRLLGEND GETRALSFTG SALAALVKGL PEALQRQFEY EDPIVRGGKQ
3841 LLHSPFFKVL VALACDLELD TLPCCAETHK WAWFRRYCMA SRVAVALDKR TPLPRLFLDE
3901 VAKKIRELMA DSENMDVLHE SHDIFKREQD EQLVQWMNRR PDDWTLSAGG SGTIYGWGHN
3961 HRGQLGGIEG AKVKVPTPCE ALATLRPVQL IGGEQTLFAV TADGKLYATG YGAGGRLGIG
4021 GTESVSTPTL LESIQHVFIK KVAVNSGGKH CLALSSEGEV YSWGEAEDGK LGHGNRSPCD
4081 RPRVIESLRG IEVVDVAAGG AHSACVTAAG DLYTWGKGRY GRLGHSDSED QLKPKLVEAL
4141 QGHRVVDIAC GSGDAQTLCL TDDDTVWSWG DGDYGKLGRG GSDGCKVPMK IDSLTGLGVV
4201 KVECGSQFSV ALTKSGAVYT WGKGDYHRLG HGSDDHVRRP RQVQGLQGKK VIAIATGSLH
4261 CVCCTEDGEV YTWGDNDEGQ LGDGTTNAIQ RPRLVAALQG KKVNRVACGS AHTLAWSTSK
4321 PASAGKLPAQ VPMEYNHLQE IPIIALRNRL LLLHHLSELF CPCIPMFDLE GSLDETGLGP
4381 SVGFDTLRGI LISQGKEAAF RKVVQATMVR DRQHGPVVEL NRIQVKRSRS KGGLAGPDGT
4441 KSVFGQMCAK MSSFGPDSLL LPHRVWKVKF VGESVDDCGG GYSESIAEIC EELQNGLTPL
4501 LIVTPNGRDE SGANRDCYLL SPAARAPVHS SMFRFLGVLL GIAIRTGSPL SLNLAEPVWK
4561 QLAGMSLTIA DLSEVDKDFI PGLMYIRDNE ATSEEFEAMS LPFTVPSASG QDIQLSSKHT
4621 HITLDNRAEY VRLAINYRLH EFDEQVAAVR EGMARVVPVP LLSLFTGYEL ETMVCGSPDI
4681 PLHLLKSVAT YKGIEPSASL IQWFWEVMES FSNTERSLFL RFVWGRTRLP RTIADFRGRD
4741 FVIQVLDKYN PPDHFLPESY TCFFLLKLPR YSCKQVLEEK LKYAIHFCKS IDTDDYARIA
4801 LTGEPAADDS SDDSDNEDVD SFASDSTQDY LTGH*

Protein predicted from variant coding sequence

No change: predicted protein (not shown) equals reference protein.

Effects on Restriction sites

Raw variant Created Deleted
1 AseI, MluCI BsgI

Experimental services

Genomic description: 12076G>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 78 -109 -32
2 79 181 -31 72
3 182 296 73 187
4 297 431 188 322
5 432 651 323 542
6 652 752 543 643
7 753 909 644 800
8 910 1020 801 911
9 1021 1192 912 1083
10 1193 1366 1084 1257
11 1367 1555 1258 1446
12 1556 1707 1447 1598
13 1708 1865 1599 1756
14 1866 1979 1757 1870
15 1980 2231 1871 2122
16 2232 2425 2123 2316
17 2426 2626 2317 2517
18 2627 2855 2518 2746
19 2856 2980 2747 2871
20 2981 3159 2872 3050
21 3160 3344 3051 3235
22 3345 3500 3236 3391
23 3501 3686 3392 3577
24 3687 3857 3578 3748
25 3858 3961 3749 3852
26 3962 4112 3853 4003
27 4113 4327 4004 4218
28 4328 4460 4219 4351
29 4461 4588 4352 4479
30 4589 4784 4480 4675
31 4785 4918 4676 4809
32 4919 5092 4810 4983
33 5093 5229 4984 5120
34 5230 5381 5121 5272
35 5382 5573 5273 5464
36 5574 5761 5465 5652
37 5762 5954 5653 5845
38 5955 6137 5846 6028
39 6138 6319 6029 6210
40 6320 6467 6211 6358
41 6468 6664 6359 6555
42 6665 6895 6556 6786
43 6896 7034 6787 6925
44 7035 7178 6926 7069
45 7179 7321 7070 7212
46 7322 7589 7213 7480
47 7590 7726 7481 7617
48 7727 7825 7618 7716
49 7826 7994 7717 7885
50 7995 8120 7886 8011
51 8121 8229 8012 8120
52 8230 8369 8121 8260
53 8370 8560 8261 8451
54 8561 8666 8452 8557
55 8667 8758 8558 8649
56 8759 8934 8650 8825
57 8935 9046 8826 8937
58 9047 9128 8938 9019
59 9129 9272 9020 9163
60 9273 9363 9164 9254
61 9364 9541 9255 9432
62 9542 9623 9433 9514
63 9624 9795 9515 9686
64 9796 9940 9687 9831
65 9941 10166 9832 10057
66 10167 10338 10058 10229
67 10339 10522 10230 10413
68 10523 10663 10414 10554
69 10664 10855 10555 10746
70 10856 11009 10747 10900
71 11010 11117 10901 11008
72 11118 11249 11009 11140
73 11250 11408 11141 11299
74 11409 11527 11300 11418
75 11528 11653 11419 11544
76 11654 11809 11545 11700
77 11810 11925 11701 11816
78 11926 12124 11817 12015
79 12125 12339 12016 12230
80 12340 12517 12231 12408
81 12518 12679 12409 12570
82 12680 12771 12571 12662
83 12772 12911 12663 12802
84 12912 13099 12803 12990
85 13100 13297 12991 13188
86 13298 13381 13189 13272
87 13382 13523 13273 13414
88 13524 13718 13415 13609
89 13719 13831 13610 13722
90 13832 14022 13723 13913
91 14023 14128 13914 14019
92 14129 14341 14020 14232
93 14342 15340 14233 *726

CDS information

g. c.
Start 110 1
Stop 14614 14505

Links

Download this reference sequence file: NM_004667.5.gb


Name ID Locus tag Product Link method
HERC2_v001 NM_004667.5 exhaustion
HERC2_i001 NP_004658.3 E3 ubiquitin-protein ligase HERC2 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.