Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: delins from 1609 to 1610

AAGCAGTGAGGTGGTGGCCATGACA CT GGAGACCAAGCCTCAGCGGAGGGAT
AAGCAGTGAGGTGGTGGCCATGACA TA GGAGACCAAGCCTCAGCGGAGGGAT

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_003741.2:n.1609_1610delinsTA

Affected transcripts - 1

Affected proteins - 1

NM_003741.2(CHRD_i001):p.(Leu455*)

Reference protein

  1  MPSLPAPPAP LLLLGLLLLG SRPARGAGPE PPVLPIRSEK EPLPVRGAAG CTFGGKVYAL
61 DETWHPDLGE PFGVMRCVLC ACEAPQWGRR TRGPGRVSCK NIKPECPTPA CGQPRQLPGH
121 CCQTCPQERS SSERQPSGLS FEYPRDPEHR SYSDRGEPGA EERARGDGHT DFVALLTGPR
181 SQAVARARVS LLRSSLRFSI SYRRLDRPTR IRFSDSNGSV LFEHPAAPTQ DGLVCGVWRA
241 VPRLSLRLLR AEQLHVALVT LTHPSGEVWG PLIRHRALAA ETFSAILTLE GPPQQGVGGI
301 TLLTLSDTED SLHFLLLFRG LLEPRSGGLT QVPLRLQILH QGQLLRELQA NVSAQEPGFA
361 EVLPNLTVQE MDWLVLGELQ MALEWAGRPG LRISGHIAAR KSCDVLQSVL CGADALIPVQ
421 TGAAGSASLT LLGNGSLIYQ VQVVGTSSEV VAMTLETKPQ RRDQRTVLCH MAGLQPGGHT
481 AVGICPGLGA RGAHMLLQNE LFLNVGTKDF PDGELRGHVA ALPYCGHSAR HDTLPVPLAG
541 ALVLPPVKSQ AAGHAWLSLD THCHLHYEVL LAGLGGSEQG TVTAHLLGPP GTPGPRRLLK
601 GFYGSEAQGV VKDLEPELLR HLAKGMASLM ITTKGSPRGE LRGQVHIANQ CEVGGLRLEA
661 AGAEGVRALG APDTASAAPP VVPGLPALAP AKPGGPGRPR DPNTCFFEGQ QRPHGARWAP
721 NYDPLCSLCT CQRRTVICDP VVCPPPSCPH PVQAPDQCCP VCPEKQDVRD LPGLPRSRDP
781 GEGCYFDGDR SWRAAGTRWH PVVPPFGLIK CAVCTCKGGT GEVHCEKVQC PRLACAQPVR
841 VNPTDCCKQC PVGSGAHPQL GDPMQADGPR GCRFAGQWFP ESQSWHPSVP PFGEMSCITC
901 RCGAGVPHCE RDDCSLPLSC GSGKESRCCS RCTAHRRPAP ETRTDPELEK EAEGS*

Protein predicted from variant coding sequence

  1  MPSLPAPPAP LLLLGLLLLG SRPARGAGPE PPVLPIRSEK EPLPVRGAAG CTFGGKVYAL
61 DETWHPDLGE PFGVMRCVLC ACEAPQWGRR TRGPGRVSCK NIKPECPTPA CGQPRQLPGH
121 CCQTCPQERS SSERQPSGLS FEYPRDPEHR SYSDRGEPGA EERARGDGHT DFVALLTGPR
181 SQAVARARVS LLRSSLRFSI SYRRLDRPTR IRFSDSNGSV LFEHPAAPTQ DGLVCGVWRA
241 VPRLSLRLLR AEQLHVALVT LTHPSGEVWG PLIRHRALAA ETFSAILTLE GPPQQGVGGI
301 TLLTLSDTED SLHFLLLFRG LLEPRSGGLT QVPLRLQILH QGQLLRELQA NVSAQEPGFA
361 EVLPNLTVQE MDWLVLGELQ MALEWAGRPG LRISGHIAAR KSCDVLQSVL CGADALIPVQ
421 TGAAGSASLT LLGNGSLIYQ VQVVGTSSEV VAMT*

Effects on Restriction sites

Raw variant Created Deleted
1 BpmI, BsrI, BstXI, LpnPI

Experimental services

Genomic description: 1609_1610delinsTA

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 394 -246 148
2 395 498 149 252
3 499 628 253 382
4 629 757 383 511
5 758 857 512 611
6 858 945 612 699
7 946 1087 700 841
8 1088 1228 842 982
9 1229 1311 983 1065
10 1312 1459 1066 1213
11 1460 1566 1214 1320
12 1567 1686 1321 1440
13 1687 1843 1441 1597
14 1844 2064 1598 1818
15 2065 2178 1819 1932
16 2179 2442 1933 2196
17 2443 2536 2197 2290
18 2537 2593 2291 2347
19 2594 2697 2348 2451
20 2698 2800 2452 2554
21 2801 2955 2555 2709
22 2956 3058 2710 2812
23 3059 3521 2813 *407

CDS information

g. c.
Start 247 1
Stop 3114 2868

Links

Download this reference sequence file: NM_003741.2.gb


Name ID Locus tag Product Link method
CHRD_v001 NM_003741.2 exhaustion
CHRD_i001 NP_003732.2 chordin precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.