Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 745

CGGGGTTGGGCCAAGATCTCCAACA T GACTTTTAGCAATGGAAAACTAATA
CGGGGTTGGGCCAAGATCTCCAACA A GACTTTTAGCAATGGAAAACTAATA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_003701.3:n.745T>A

Affected transcripts - 1

Affected proteins - 1

NM_003701.3(TNFSF11_i001):p.(Met199Lys)

Reference protein

  1  MRRASRDYTK YLRGSEEMGG GPGAPHEGPL HAPPPPAPHQ PPAASRSMFV ALLGLGLGQV
61 VCSVALFFYF RAQMDPNRIS EDGTHCIYRI LRLHENADFQ DTTLESQDTK LIPDSCRRIK
121 QAFQGAVQKE LQHIVGSQHI RAEKAMVDGS WLDLAKRSKL EAQPFAHLTI NATDIPSGSH
181 KVSLSSWYHD RGWAKISNMT FSNGKLIVNQ DGFYYLYANI CFRHHETSGD LATEYLQLMV
241 YVTKTSIKIP SSHTLMKGGS TKYWSGNSEF HFYSINVGGF FKLRSGEEIS IEVSNPSLLD
301 PDQDATYFGA FKVRDID*

Protein predicted from variant coding sequence

  1  MRRASRDYTK YLRGSEEMGG GPGAPHEGPL HAPPPPAPHQ PPAASRSMFV ALLGLGLGQV
61 VCSVALFFYF RAQMDPNRIS EDGTHCIYRI LRLHENADFQ DTTLESQDTK LIPDSCRRIK
121 QAFQGAVQKE LQHIVGSQHI RAEKAMVDGS WLDLAKRSKL EAQPFAHLTI NATDIPSGSH
181 KVSLSSWYHD RGWAKISNKT FSNGKLIVNQ DGFYYLYANI CFRHHETSGD LATEYLQLMV
241 YVTKTSIKIP SSHTLMKGGS TKYWSGNSEF HFYSINVGGF FKLRSGEEIS IEVSNPSLLD
301 PDQDATYFGA FKVRDID*

Effects on Restriction sites

Raw variant Created Deleted
1 CviAII, FatI, NlaIII

Experimental services

Genomic description: 745T>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 368 -149 219
2 369 536 220 387
3 537 582 388 433
4 583 681 434 532
5 682 2198 533 *1095

CDS information

g. c.
Start 150 1
Stop 1103 954

Links

Download this reference sequence file: NM_003701.3.gb


Name ID Locus tag Product Link method
TNFSF11_v001 NM_003701.3 exhaustion
TNFSF11_i001 NP_003692.1 tumor necrosis factor ligand superfamily member 11 isoform 1 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.