Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 851

TTGCTGGCCTGGACCTTCCTTCCAC C TTCACTGAAACCACCCTGTACCGGA
TTGCTGGCCTGGACCTTCCTTCCAC A TTCACTGAAACCACCCTGTACCGGA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_003235.4:n.851C>A

Affected transcripts - 1

Affected proteins - 1

NM_003235.4(TG_i001):p.(=)

Reference protein

   1  MALVLEIFTL LASICWVSAN IFEYQVDAQP LRPCELQRET AFLKQADYVP QCAEDGSFQT
61 VQCQNDGRSC WCVGANGSEV LGSRQPGRPV ACLSFCQLQK QQILLSGYIN STDTSYLPQC
121 QDSGDYAPVQ CDVQQVQCWC VDAEGMEVYG TRQLGRPKRC PRSCEIRNRR LLHGVGDKSP
181 PQCSAEGEFM PVQCKFVNTT DMMIFDLVHS YNRFPDAFVT FSSFQRRFPE VSGYCHCADS
241 QGRELAETGL ELLLDEIYDT IFAGLDLPST FTETTLYRIL QRRFLAVQSV ISGRFRCPTK
301 CEVERFTATS FGHPYVPSCR RNGDYQAVQC QTEGPCWCVD AQGKEMHGTR QQGEPPSCAE
361 GQSCASERQQ ALSRLYFGTS GYFSQHDLFS SPEKRWASPR VARFATSCPP TIKELFVDSG
421 LLRPMVEGQS QQFSVSENLL KEAIRAIFPS RGLARLALQF TTNPKRLQQN LFGGKFLVNV
481 GQFNLSGALG TRGTFNFSQF FQQLGLASFL NGGRQEDLAK PLSVGLDSNS STGTPEAAKK
541 DGTMNKPTVG SFGFEINLQE NQNALKFLAS LLELPEFLLF LQHAISVPED VARDLGDVME
601 TVLSSQTCEQ TPERLFVPSC TTEGSYEDVQ CFSGECWCVN SWGKELPGSR VRGGQPRCPT
661 DCEKQRARMQ SLMGSQPAGS TLFVPACTSE GHFLPVQCFN SECYCVDAEG QAIPGTRSAI
721 GKPKKCPTPC QLQSEQAFLR TVQALLSNSS MLPTLSDTYI PQCSTDGQWR QVQCNGPPEQ
781 VFELYQRWEA QNKGQDLTPA KLLVKIMSYR EAASGNFSLF IQSLYEAGQQ DVFPVLSQYP
841 SLQDVPLAAL EGKRPQPREN ILLEPYLFWQ ILNGQLSQYP GSYSDFSTPL AHFDLRNCWC
901 VDEAGQELEG MRSEPSKLPT CPGSCEEAKL RVLQFIRETE EIVSASNSSR FPLGESFLVA
961 KGIRLRNEDL GLPPLFPPRE AFAEQFLRGS DYAIRLAAQS TLSFYQRRRF SPDDSAGASA
1021 LLRSGPYMPQ CDAFGSWEPV QCHAGTGHCW CVDEKGGFIP GSLTARSLQI PQCPTTCEKS
1081 RTSGLLSSWK QARSQENPSP KDLFVPACLE TGEYARLQAS GAGTWCVDPA SGEELRPGSS
1141 SSAQCPSLCN VLKSGVLSRR VSPGYVPACR AEDGGFSPVQ CDQAQGSCWC VMDSGEEVPG
1201 TRVTGGQPAC ESPRCPLPFN ASEVVGGTIL CETISGPTGS AMQQCQLLCR QGSWSVFPPG
1261 PLICSLESGR WESQLPQPRA CQRPQLWQTI QTQGHFQLQL PPGKMCSADY ADLLQTFQVF
1321 ILDELTARGF CQIQVKTFGT LVSIPVCNNS SVQVGCLTRE RLGVNVTWKS RLEDIPVASL
1381 PDLHDIERAL VGKDLLGRFT DLIQSGSFQL HLDSKTFPAE TIRFLQGDHF GTSPRTWFGC
1441 SEGFYQVLTS EASQDGLGCV KCPEGSYSQD EECIPCPVGF YQEQAGSLAC VPCPVGRTTI
1501 SAGAFSQTHC VTDCQRNEAG LQCDQNGQYR ASQKDRGSGK AFCVDGEGRR LPWWETEAPL
1561 EDSQCLMMQK FEKVPESKVI FDANAPVAVR SKVPDSEFPV MQCLTDCTED EACSFFTVST
1621 TEPEISCDFY AWTSDNVACM TSDQKRDALG NSKATSFGSL RCQVKVRSHG QDSPAVYLKK
1681 GQGSTTTLQK RFEPTGFQNM LSGLYNPIVF SASGANLTDA HLFCLLACDR DLCCDGFVLT
1741 QVQGGAIICG LLSSPSVLLC NVKDWMDPSE AWANATCPGV TYDQESHQVI LRLGDQEFIK
1801 SLTPLEGTQD TFTNFQQVYL WKDSDMGSRP ESMGCRKDTV PRPASPTEAG LTTELFSPVD
1861 LNQVIVNGNQ SLSSQKHWLF KHLFSAQQAN LWCLSRCVQE HSFCQLAEIT ESASLYFTCT
1921 LYPEAQVCDD IMESNAQGCR LILPQMPKAL FRKKVILEDK VKNFYTRLPF QKLMGISIRN
1981 KVPMSEKSIS NGFFECERRC DADPCCTGFG FLNVSQLKGG EVTCLTLNSL GIQMCSEENG
2041 GAWRILDCGS PDIEVHTYPF GWYQKPIAQN NAPSFCPLVV LPSLTEKVSL DSWQSLALSS
2101 VVVDPSIRHF DVAHVSTAAT SNFSAVRDLC LSECSQHEAC LITTLQTQPG AVRCMFYADT
2161 QSCTHSLQGQ NCRLLLREEA THIYRKPGIS LLSYEASVPS VPISTHGRLL GRSQAIQVGT
2221 SWKQVDQFLG VPYAAPPLAE RRFQAPEPLN WTGSWDASKP RASCWQPGTR TSTSPGVSED
2281 CLYLNVFIPQ NVAPNASVLV FFHNTMDREE SEGWPAIDGS FLAAVGNLIV VTASYRVGVF
2341 GFLSSGSGEV SGNWGLLDQV AALTWVQTHI RGFGGDPRRV SLAADRGGAD VASIHLLTAR
2401 ATNSQLFRRA VLMGGSALSP AAVISHERAQ QQAIALAKEV SCPMSSSQEV VSCLRQKPAN
2461 VLNDAQTKLL AVSGPFHYWG PVIDGHFLRE PPARALKRSL WVEVDLLIGS SQDDGLINRA
2521 KAVKQFEESR GRTSSKTAFY QALQNSLGGE DSDARVEAAA TWYYSLEHST DDYASFSRAL
2581 ENATRDYFII CPIIDMASAW AKRARGNVFM YHAPENYGHG SLELLADVQF ALGLPFYPAY
2641 EGQFSLEEKS LSLKIMQYFS HFIRSGNPNY PYEFSRKVPT FATPWPDFVP RAGGENYKEF
2701 SELLPNRQGL KKADCSFWSK YISSLKTSAD GAKGGQSAES EEEELTAGSG LREDLLSLQE
2761 PGSKTYSK*

Protein predicted from variant coding sequence

No change: predicted protein (not shown) equals reference protein.

Effects on Restriction sites

Raw variant Created Deleted
1

Experimental services

Genomic description: 851C>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 108 -41 67
2 109 217 68 176
3 218 315 177 274
4 316 519 275 478
5 520 679 479 638
6 680 786 639 745
7 787 930 746 889
8 931 1116 890 1075
9 1117 2217 1076 2176
10 2218 2802 2177 2761
11 2803 3042 2762 3001
12 3043 3180 3002 3139
13 3181 3258 3140 3217
14 3259 3371 3218 3330
15 3372 3474 3331 3433
16 3475 3675 3434 3634
17 3676 3888 3635 3847
18 3889 4043 3848 4002
19 4044 4200 4003 4159
20 4201 4419 4160 4378
21 4420 4569 4379 4528
22 4570 4740 4529 4699
23 4741 4857 4700 4816
24 4858 4973 4817 4932
25 4974 5082 4933 5041
26 5083 5274 5042 5233
27 5275 5442 5234 5401
28 5443 5508 5402 5467
29 5509 5589 5468 5548
30 5590 5727 5549 5686
31 5728 5904 5687 5863
32 5905 6016 5864 5975
33 6017 6096 5976 6055
34 6097 6240 6056 6199
35 6241 6303 6200 6262
36 6304 6438 6263 6397
37 6439 6603 6398 6562
38 6604 6823 6563 6782
39 6824 6917 6783 6876
40 6918 7077 6877 7036
41 7078 7280 7037 7239
42 7281 7445 7240 7404
43 7446 7613 7405 7572
44 7614 7795 7573 7754
45 7796 7903 7755 7862
46 7904 8038 7863 7997
47 8039 8229 7998 8188
48 8230 8453 8189 *105

CDS information

g. c.
Start 42 1
Stop 8348 8307

Links

Download this reference sequence file: NM_003235.4.gb


Name ID Locus tag Product Link method
TG_v001 NM_003235.4 exhaustion
TG_i001 NP_003226.4 thyroglobulin precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.