Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 161

CTTTCAGCATCCAAGTCCATAAGAA A TTTAGATGATGACATGGTATTTAAT
CTTTCAGCATCCAAGTCCATAAGAA G TTTAGATGATGACATGGTATTTAAT

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_002674.2:n.161A>G

Affected transcripts - 1

Affected proteins - 1

NM_002674.2(PMCH_i001):p.(Asn32Ser)

Reference protein

  1  MAKMNLSSYI LILTFSLFSQ GILLSASKSI RNLDDDMVFN TFRLGKGFQK EDTAEKSVIA
61 PSLEQYKNDE SSFMNEEENK VSKNTGSKHN FLNHGLPLNL AIKPYLALKG SVAFPAENGV
121 QNTESTQEKR EIGDEENSAK FPIGRRDFDM LRCMLGRVYR PCWQV*

Protein predicted from variant coding sequence

  1  MAKMNLSSYI LILTFSLFSQ GILLSASKSI RSLDDDMVFN TFRLGKGFQK EDTAEKSVIA
61 PSLEQYKNDE SSFMNEEENK VSKNTGSKHN FLNHGLPLNL AIKPYLALKG SVAFPAENGV
121 QNTESTQEKR EIGDEENSAK FPIGRRDFDM LRCMLGRVYR PCWQV*

Effects on Restriction sites

Raw variant Created Deleted
1 ApoI, MluCI

Experimental services

Genomic description: 161A>G

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 67 564 1 498

CDS information

g. c.
Start 67 1
Stop 564 498

Links

Download this reference sequence file: NM_002674.2.gb


Name ID Locus tag Product Link method
PMCH_v001 NM_002674.2 construction
PMCH_i001 NP_002665.2 pro-MCH preproprotein construction

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.