Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1855

GCGCTACCACAGCATCGTGACCCTG C CGCGGGCGCGGCGAGCCGTTGCGGC
GCGCTACCACAGCATCGTGACCCTG A CGCGGGCGCGGCGAGCCGTTGCGGC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_002386.3:n.1855C>A

Affected transcripts - 1

Affected proteins - 1

NM_002386.3(MC1R_i001):p.(Pro159Thr)

Reference protein

  1  MAVQGSQRRL LGSLNSTPTA IPQLGLAANQ TGARCLEVSI SDGLFLSLGL VSLVENALVV
61 ATIAKNRNLH SPMYCFICCL ALSDLLVSGS NVLETAVILL LEAGALVARA AVLQQLDNVI
121 DVITCSSMLS SLCFLGAIAV DRYISIFYAL RYHSIVTLPR ARRAVAAIWV ASVVFSTLFI
181 AYYDHVAVLL CLVVFFLAML VLMAVLYVHM LARACQHAQG IARLHKRQRP VHQGFGLKGA
241 VTLTILLGIF FLCWGPFFLH LTLIVLCPEH PTCGCIFKNF NLFLALIICN AIIDPLIYAF
301 HSQELRRTLK EVLTCSW*

Protein predicted from variant coding sequence

  1  MAVQGSQRRL LGSLNSTPTA IPQLGLAANQ TGARCLEVSI SDGLFLSLGL VSLVENALVV
61 ATIAKNRNLH SPMYCFICCL ALSDLLVSGS NVLETAVILL LEAGALVARA AVLQQLDNVI
121 DVITCSSMLS SLCFLGAIAV DRYISIFYAL RYHSIVTLTR ARRAVAAIWV ASVVFSTLFI
181 AYYDHVAVLL CLVVFFLAML VLMAVLYVHM LARACQHAQG IARLHKRQRP VHQGFGLKGA
241 VTLTILLGIF FLCWGPFFLH LTLIVLCPEH PTCGCIFKNF NLFLALIICN AIIDPLIYAF
301 HSQELRRTLK EVLTCSW*

Effects on Restriction sites

Raw variant Created Deleted
1 HgaI BsaJI, BtgI, MspA1I, SacII

Experimental services

Genomic description: 1855C>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 3099 -1380 *765

CDS information

g. c.
Start 1381 1
Stop 2334 954

Links

Download this reference sequence file: NM_002386.3.gb


Name ID Locus tag Product Link method
MC1R_v001 NM_002386.3 exhaustion
MC1R_i001 NP_002377.4 melanocyte-stimulating hormone receptor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.