Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: delins from 1821 to 1822

AGGCGTAGCATTGAAAGAGTTCATA AA CGAAGTGCAGAGAGGGAAGTGATCA
AGGCGTAGCATTGAAAGAGTTCATA TG CGAAGTGCAGAGAGGGAAGTGATCA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_002336.2:n.1821_1822delinsTG

Affected transcripts - 1

Affected proteins - 1

NM_002336.2(LRP6_i001):p.(Lys560Met)

Reference protein

   1  MGAVLRSLLA CSFCVLLRAA PLLLYANRRD LRLVDATNGK ENATIVVGGL EDAAAVDFVF
61 SHGLIYWSDV SEEAIKRTEF NKTESVQNVV VSGLLSPDGL ACDWLGEKLY WTDSETNRIE
121 VSNLDGSLRK VLFWQELDQP RAIALDPSSG FMYWTDWGEV PKIERAGMDG SSRFIIINSE
181 IYWPNGLTLD YEEQKLYWAD AKLNFIHKSN LDGTNRQAVV KGSLPHPFAL TLFEDILYWT
241 DWSTHSILAC NKYTGEGLRE IHSDIFSPMD IHAFSQQRQP NATNPCGIDN GGCSHLCLMS
301 PVKPFYQCAC PTGVKLLENG KTCKDGATEL LLLARRTDLR RISLDTPDFT DIVLQLEDIR
361 HAIAIDYDPV EGYIYWTDDE VRAIRRSFID GSGSQFVVTA QIAHPDGIAV DWVARNLYWT
421 DTGTDRIEVT RLNGTMRKIL ISEDLEEPRA IVLDPMVGYM YWTDWGEIPK IERAALDGSD
481 RVVLVNTSLG WPNGLALDYD EGKIYWGDAK TDKIEVMNTD GTGRRVLVED KIPHIFGFTL
541 LGDYVYWTDW QRRSIERVHK RSAEREVIID QLPDLMGLKA TNVHRVIGSN PCAEENGGCS
601 HLCLYRPQGL RCACPIGFEL ISDMKTCIVP EAFLLFSRRA DIRRISLETN NNNVAIPLTG
661 VKEASALDFD VTDNRIYWTD ISLKTISRAF MNGSALEHVV EFGLDYPEGM AVDWLGKNLY
721 WADTGTNRIE VSKLDGQHRQ VLVWKDLDSP RALALDPAEG FMYWTEWGGK PKIDRAAMDG
781 SERTTLVPNV GRANGLTIDY AKRRLYWTDL DTNLIESSNM LGLNREVIAD DLPHPFGLTQ
841 YQDYIYWTDW SRRSIERANK TSGQNRTIIQ GHLDYVMDIL VFHSSRQSGW NECASSNGHC
901 SHLCLAVPVG GFVCGCPAHY SLNADNRTCS APTTFLLFSQ KSAINRMVID EQQSPDIILP
961 IHSLRNVRAI DYDPLDKQLY WIDSRQNMIR KAQEDGSQGF TVVVSSVPSQ NLEIQPYDLS
1021 IDIYSRYIYW TCEATNVINV TRLDGRSVGV VLKGEQDRPR AVVVNPEKGY MYFTNLQERS
1081 PKIERAALDG TEREVLFFSG LSKPIALALD SRLGKLFWAD SDLRRIESSD LSGANRIVLE
1141 DSNILQPVGL TVFENWLYWI DKQQQMIEKI DMTGREGRTK VQARIAQLSD IHAVKELNLQ
1201 EYRQHPCAQD NGGCSHICLV KGDGTTRCSC PMHLVLLQDE LSCGEPPTCS PQQFTCFTGE
1261 IDCIPVAWRC DGFTECEDHS DELNCPVCSE SQFQCASGQC IDGALRCNGD ANCQDKSDEK
1321 NCEVLCLIDQ FRCANGQCIG KHKKCDHNVD CSDKSDELDC YPTEEPAPQA TNTVGSVIGV
1381 IVTIFVSGTV YFICQRMLCP RMKGDGETMT NDYVVHGPAS VPLGYVPHPS SLSGSLPGMS
1441 RGKSMISSLS IMGGSSGPPY DRAHVTGASS SSSSSTKGTY FPAILNPPPS PATERSHYTM
1501 EFGYSSNSPS THRSYSYRPY SYRHFAPPTT PCSTDVCDSD YAPSRRMTSV ATAKGYTSDL
1561 NYDSEPVPPP PTPRSQYLSA EENYESCPPS PYTERSYSHH LYPPPPSPCT DSS*

Protein predicted from variant coding sequence

   1  MGAVLRSLLA CSFCVLLRAA PLLLYANRRD LRLVDATNGK ENATIVVGGL EDAAAVDFVF
61 SHGLIYWSDV SEEAIKRTEF NKTESVQNVV VSGLLSPDGL ACDWLGEKLY WTDSETNRIE
121 VSNLDGSLRK VLFWQELDQP RAIALDPSSG FMYWTDWGEV PKIERAGMDG SSRFIIINSE
181 IYWPNGLTLD YEEQKLYWAD AKLNFIHKSN LDGTNRQAVV KGSLPHPFAL TLFEDILYWT
241 DWSTHSILAC NKYTGEGLRE IHSDIFSPMD IHAFSQQRQP NATNPCGIDN GGCSHLCLMS
301 PVKPFYQCAC PTGVKLLENG KTCKDGATEL LLLARRTDLR RISLDTPDFT DIVLQLEDIR
361 HAIAIDYDPV EGYIYWTDDE VRAIRRSFID GSGSQFVVTA QIAHPDGIAV DWVARNLYWT
421 DTGTDRIEVT RLNGTMRKIL ISEDLEEPRA IVLDPMVGYM YWTDWGEIPK IERAALDGSD
481 RVVLVNTSLG WPNGLALDYD EGKIYWGDAK TDKIEVMNTD GTGRRVLVED KIPHIFGFTL
541 LGDYVYWTDW QRRSIERVHM RSAEREVIID QLPDLMGLKA TNVHRVIGSN PCAEENGGCS
601 HLCLYRPQGL RCACPIGFEL ISDMKTCIVP EAFLLFSRRA DIRRISLETN NNNVAIPLTG
661 VKEASALDFD VTDNRIYWTD ISLKTISRAF MNGSALEHVV EFGLDYPEGM AVDWLGKNLY
721 WADTGTNRIE VSKLDGQHRQ VLVWKDLDSP RALALDPAEG FMYWTEWGGK PKIDRAAMDG
781 SERTTLVPNV GRANGLTIDY AKRRLYWTDL DTNLIESSNM LGLNREVIAD DLPHPFGLTQ
841 YQDYIYWTDW SRRSIERANK TSGQNRTIIQ GHLDYVMDIL VFHSSRQSGW NECASSNGHC
901 SHLCLAVPVG GFVCGCPAHY SLNADNRTCS APTTFLLFSQ KSAINRMVID EQQSPDIILP
961 IHSLRNVRAI DYDPLDKQLY WIDSRQNMIR KAQEDGSQGF TVVVSSVPSQ NLEIQPYDLS
1021 IDIYSRYIYW TCEATNVINV TRLDGRSVGV VLKGEQDRPR AVVVNPEKGY MYFTNLQERS
1081 PKIERAALDG TEREVLFFSG LSKPIALALD SRLGKLFWAD SDLRRIESSD LSGANRIVLE
1141 DSNILQPVGL TVFENWLYWI DKQQQMIEKI DMTGREGRTK VQARIAQLSD IHAVKELNLQ
1201 EYRQHPCAQD NGGCSHICLV KGDGTTRCSC PMHLVLLQDE LSCGEPPTCS PQQFTCFTGE
1261 IDCIPVAWRC DGFTECEDHS DELNCPVCSE SQFQCASGQC IDGALRCNGD ANCQDKSDEK
1321 NCEVLCLIDQ FRCANGQCIG KHKKCDHNVD CSDKSDELDC YPTEEPAPQA TNTVGSVIGV
1381 IVTIFVSGTV YFICQRMLCP RMKGDGETMT NDYVVHGPAS VPLGYVPHPS SLSGSLPGMS
1441 RGKSMISSLS IMGGSSGPPY DRAHVTGASS SSSSSTKGTY FPAILNPPPS PATERSHYTM
1501 EFGYSSNSPS THRSYSYRPY SYRHFAPPTT PCSTDVCDSD YAPSRRMTSV ATAKGYTSDL
1561 NYDSEPVPPP PTPRSQYLSA EENYESCPPS PYTERSYSHH LYPPPPSPCT DSS*

Effects on Restriction sites

Raw variant Created Deleted
1 NdeI

Experimental services

Genomic description: 1821_1822delinsTG

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 197 -142 55
2 198 591 56 449
3 592 789 450 647
4 790 986 648 844
5 987 1118 845 976
6 1119 1515 977 1373
7 1516 1687 1374 1545
8 1688 1904 1546 1762
9 1905 2194 1763 2052
10 2195 2421 2053 2279
11 2422 2606 2280 2464
12 2607 2933 2465 2791
13 2934 3136 2792 2994
14 3137 3348 2995 3206
15 3349 3539 3207 3397
16 3540 3749 3398 3607
17 3750 3875 3608 3733
18 3876 4112 3734 3970
19 4113 4223 3971 4081
20 4224 4454 4082 4312
21 4455 4591 4313 4449
22 4592 4689 4450 4547
23 4690 10085 4548 *5101

CDS information

g. c.
Start 143 1
Stop 4984 4842

Links

Download this reference sequence file: NM_002336.2.gb


Name ID Locus tag Product Link method
LRP6_v001 NM_002336.2 exhaustion
LRP6_i001 NP_002327.2 low-density lipoprotein receptor-related protein 6 precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.