Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 547

ATTCTTCCCTGAATACAAGAACTCA G AAAGCACGTCATTGTGGCCATTGTC
ATTCTTCCCTGAATACAAGAACTCA T AAAGCACGTCATTGTGGCCATTGTC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_002259.4:n.547G>T

Affected transcripts - 1

Affected proteins - 1

NM_002259.4(KLRC1_i001):p.(Gln111His)

Reference protein

  1  MDNQGVIYSD LNLPPNPKRQ QRKPKGNKSS ILATEQEITY AELNLQKASQ DFQGNDKTYH
61 CKDLPSAPEK LIVGILGIIC LILMASVVTI VVIPSTLIQR HNNSSLNTRT QKARHCGHCP
121 EEWITYSNSC YYIGKERRTW EESLLACTSK NSSLLSIDNE EEMKFLSIIS PSSWIGVFRN
181 SSHHPWVTMN GLAFKHEIKD SDNAELNCAV LQVNRLKSAQ CGSSIIYHCK HKL*

Protein predicted from variant coding sequence

  1  MDNQGVIYSD LNLPPNPKRQ QRKPKGNKSS ILATEQEITY AELNLQKASQ DFQGNDKTYH
61 CKDLPSAPEK LIVGILGIIC LILMASVVTI VVIPSTLIQR HNNSSLNTRT HKARHCGHCP
121 EEWITYSNSC YYIGKERRTW EESLLACTSK NSSLLSIDNE EEMKFLSIIS PSSWIGVFRN
181 SSHHPWVTMN GLAFKHEIKD SDNAELNCAV LQVNRLKSAQ CGSSIIYHCK HKL*

Effects on Restriction sites

Raw variant Created Deleted
1 BspCNI, DdeI, Hpy188I

Experimental services

Genomic description: 547G>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 183 -214 -32
2 184 401 -31 187
3 402 497 188 283
4 498 551 284 337
5 552 703 338 489
6 704 804 490 590
7 805 1439 591 *523

CDS information

g. c.
Start 215 1
Stop 916 702

Links

Download this reference sequence file: NM_002259.4.gb


Name ID Locus tag Product Link method
KLRC1_v001 NM_002259.4 exhaustion
KLRC1_i001 NP_002250.1 NKG2-A/NKG2-B type II integral membrane protein isoform NKG2-A exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.