Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: delins from 3271 to 3272

GAGCCCCTACACAGTGGAGGCCTCG CT GCCACCAGATCCCAGCAAGGTGAAG
GAGCCCCTACACAGTGGAGGCCTCG TG GCCACCAGATCCCAGCAAGGTGAAG

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_001457.3:n.3271_3272delinsTG

Affected transcripts - 1

Affected proteins - 1

NM_001457.3(FLNB_i001):p.(Leu1036Trp)

Reference protein

   1  MPVTEKDLAE DAPWKKIQQN TFTRWCNEHL KCVNKRIGNL QTDLSDGLRL IALLEVLSQK
61 RMYRKYHQRP TFRQMQLENV SVALEFLDRE SIKLVSIDSK AIVDGNLKLI LGLVWTLILH
121 YSISMPVWED EGDDDAKKQT PKQRLLGWIQ NKIPYLPITN FNQNWQDGKA LGALVDSCAP
181 GLCPDWESWD PQKPVDNARE AMQQADDWLG VPQVITPEEI IHPDVDEHSV MTYLSQFPKA
241 KLKPGAPLKP KLNPKKARAY GRGIEPTGNM VKQPAKFTVD TISAGQGDVM VFVEDPEGNK
301 EEAQVTPDSD KNKTYSVEYL PKVTGLHKVT VLFAGQHISK SPFEVSVDKA QGDASKVTAK
361 GPGLEAVGNI ANKPTYFDIY TAGAGVGDIG VEVEDPQGKN TVELLVEDKG NQVYRCVYKP
421 MQPGPHVVKI FFAGDTIPKS PFVVQVGEAC NPNACRASGR GLQPKGVRIR ETTDFKVDTK
481 AAGSGELGVT MKGPKGLEEL VKQKDFLDGV YAFEYYPSTP GRYSIAITWG GHHIPKSPFE
541 VQVGPEAGMQ KVRAWGPGLH GGIVGRSADF VVESIGSEVG SLGFAIEGPS QAKIEYNDQN
601 DGSCDVKYWP KEPGEYAVHI MCDDEDIKDS PYMAFIHPAT GGYNPDLVRA YGPGLEKSGC
661 IVNNLAEFTV DPKDAGKAPL KIFAQDGEGQ RIDIQMKNRM DGTYACSYTP VKAIKHTIAV
721 VWGGVNIPHS PYRVNIGQGS HPQKVKVFGP GVERSGLKAN EPTHFTVDCT EAGEGDVSVG
781 IKCDARVLSE DEEDVDFDII HNANDTFTVK YVPPAAGRYT IKVLFASQEI PASPFRVKVD
841 PSHDASKVKA EGPGLSKAGV ENGKPTHFTV YTKGAGKAPL NVQFNSPLPG DAVKDLDIID
901 NYDYSHTVKY TPTQQGNMQV LVTYGGDPIP KSPFTVGVAA PLDLSKIKLN GLENRVEVGK
961 DQEFTVDTRG AGGQGKLDVT ILSPSRKVVP CLVTPVTGRE NSTAKFIPRE EGLYAVDVTY
1021 DGHPVPGSPY TVEASLPPDP SKVKAHGPGL EGGLVGKPAE FTIDTKGAGT GGLGLTVEGP
1081 CEAKIECSDN GDGTCSVSYL PTKPGEYFVN ILFEEVHIPG SPFKADIEMP FDPSKVVASG
1141 PGLEHGKVGE AGLLSVDCSE AGPGALGLEA VSDSGTKAEV SIQNNKDGTY AVTYVPLTAG
1201 MYTLTMKYGG ELVPHFPARV KVEPAVDTSR IKVFGPGIEG KDVFREATTD FTVDSRPLTQ
1261 VGGDHIKAHI ANPSGASTEC FVTDNADGTY QVEYTPFEKG LHVVEVTYDD VPIPNSPFKV
1321 AVTEGCQPSR VQAQGPGLKE AFTNKPNVFT VVTRGAGIGG LGITVEGPSE SKINCRDNKD
1381 GSCSAEYIPF APGDYDVNIT YGGAHIPGSP FRVPVKDVVD PSKVKIAGPG LGSGVRARVL
1441 QSFTVDSSKA GLAPLEVRVL GPRGLVEPVN VVDNGDGTHT VTYTPSQEGP YMVSVKYADE
1501 EIPRSPFKVK VLPTYDASKV TASGPGLSSY GVPASLPVDF AIDARDAGEG LLAVQITDQE
1561 GKPKRAIVHD NKDGTYAVTY IPDKTGRYMI GVTYGGDDIP LSPYRIRATQ TGDASKCLAT
1621 GPGIASTVKT GEEVGFVVDA KTAGKGKVTC TVLTPDGTEA EADVIENEDG TYDIFYTAAK
1681 PGTYVIYVRF GGVDIPNSPF TVMATDGEVT AVEEAPVNAC PPGFRPWVTE EAYVPVSDMN
1741 GLGFKPFDLV IPFAVRKGEI TGEVHMPSGK TATPEIVDNK DGTVTVRYAP TEVGLHEMHI
1801 KYMGSHIPES PLQFYVNYPN SGSVSAYGPG LVYGVANKTA TFTIVTEDAG EGGLDLAIEG
1861 PSKAEISCID NKDGTCTVTY LPTLPGDYSI LVKYNDKHIP GSPFTAKITD DSRRCSQVKL
1921 GSAADFLLDI SETDLSSLTA SIKAPSGRDE PCLLKRLPNN HIGISFIPRE VGEHLVSIKK
1981 NGNHVANSPV SIMVVQSEIG DARRAKVYGR GLSEGRTFEM SDFIVDTRDA GYGGISLAVE
2041 GPSKVDIQTE DLEDGTCKVS YFPTVPGVYI VSTKFADEHV PGSPFTVKIS GEGRVKESIT
2101 RTSRAPSVAT VGSICDLNLK IPEINSSDMS AHVTSPSGRV TEAEIVPMGK NSHCVRFVPQ
2161 EMGVHTVSVK YRGQHVTGSP FQFTVGPLGE GGAHKVRAGG PGLERGEAGV PAEFSIWTRE
2221 AGAGGLSIAV EGPSKAEITF DDHKNGSCGV SYIAQEPGNY EVSIKFNDEH IPESPYLVPV
2281 IAPSDDARRL TVMSLQESGL KVNQPASFAI RLNGAKGKID AKVHSPSGAV EECHVSELEP
2341 DKYAVRFIPH ENGVHTIDVK FNGSHVVGSP FKVRVGEPGQ AGNPALVSAY GTGLEGGTTG
2401 IQSEFFINTT RAGPGTLSVT IEGPSKVKMD CQETPEGYKV MYTPMAPGNY LISVKYGGPN
2461 HIVGSPFKAK VTGQRLVSPG SANETSSILV ESVTRSSTET CYSAIPKASS DASKVTSKGA
2521 GLSKAFVGQK SSFLVDCSKA GSNMLLIGVH GPTTPCEEVS MKHVGNQQYN VTYVVKERGD
2581 YVLAVKWGEE HIPGSPFHVT VP*

Protein predicted from variant coding sequence

   1  MPVTEKDLAE DAPWKKIQQN TFTRWCNEHL KCVNKRIGNL QTDLSDGLRL IALLEVLSQK
61 RMYRKYHQRP TFRQMQLENV SVALEFLDRE SIKLVSIDSK AIVDGNLKLI LGLVWTLILH
121 YSISMPVWED EGDDDAKKQT PKQRLLGWIQ NKIPYLPITN FNQNWQDGKA LGALVDSCAP
181 GLCPDWESWD PQKPVDNARE AMQQADDWLG VPQVITPEEI IHPDVDEHSV MTYLSQFPKA
241 KLKPGAPLKP KLNPKKARAY GRGIEPTGNM VKQPAKFTVD TISAGQGDVM VFVEDPEGNK
301 EEAQVTPDSD KNKTYSVEYL PKVTGLHKVT VLFAGQHISK SPFEVSVDKA QGDASKVTAK
361 GPGLEAVGNI ANKPTYFDIY TAGAGVGDIG VEVEDPQGKN TVELLVEDKG NQVYRCVYKP
421 MQPGPHVVKI FFAGDTIPKS PFVVQVGEAC NPNACRASGR GLQPKGVRIR ETTDFKVDTK
481 AAGSGELGVT MKGPKGLEEL VKQKDFLDGV YAFEYYPSTP GRYSIAITWG GHHIPKSPFE
541 VQVGPEAGMQ KVRAWGPGLH GGIVGRSADF VVESIGSEVG SLGFAIEGPS QAKIEYNDQN
601 DGSCDVKYWP KEPGEYAVHI MCDDEDIKDS PYMAFIHPAT GGYNPDLVRA YGPGLEKSGC
661 IVNNLAEFTV DPKDAGKAPL KIFAQDGEGQ RIDIQMKNRM DGTYACSYTP VKAIKHTIAV
721 VWGGVNIPHS PYRVNIGQGS HPQKVKVFGP GVERSGLKAN EPTHFTVDCT EAGEGDVSVG
781 IKCDARVLSE DEEDVDFDII HNANDTFTVK YVPPAAGRYT IKVLFASQEI PASPFRVKVD
841 PSHDASKVKA EGPGLSKAGV ENGKPTHFTV YTKGAGKAPL NVQFNSPLPG DAVKDLDIID
901 NYDYSHTVKY TPTQQGNMQV LVTYGGDPIP KSPFTVGVAA PLDLSKIKLN GLENRVEVGK
961 DQEFTVDTRG AGGQGKLDVT ILSPSRKVVP CLVTPVTGRE NSTAKFIPRE EGLYAVDVTY
1021 DGHPVPGSPY TVEASWPPDP SKVKAHGPGL EGGLVGKPAE FTIDTKGAGT GGLGLTVEGP
1081 CEAKIECSDN GDGTCSVSYL PTKPGEYFVN ILFEEVHIPG SPFKADIEMP FDPSKVVASG
1141 PGLEHGKVGE AGLLSVDCSE AGPGALGLEA VSDSGTKAEV SIQNNKDGTY AVTYVPLTAG
1201 MYTLTMKYGG ELVPHFPARV KVEPAVDTSR IKVFGPGIEG KDVFREATTD FTVDSRPLTQ
1261 VGGDHIKAHI ANPSGASTEC FVTDNADGTY QVEYTPFEKG LHVVEVTYDD VPIPNSPFKV
1321 AVTEGCQPSR VQAQGPGLKE AFTNKPNVFT VVTRGAGIGG LGITVEGPSE SKINCRDNKD
1381 GSCSAEYIPF APGDYDVNIT YGGAHIPGSP FRVPVKDVVD PSKVKIAGPG LGSGVRARVL
1441 QSFTVDSSKA GLAPLEVRVL GPRGLVEPVN VVDNGDGTHT VTYTPSQEGP YMVSVKYADE
1501 EIPRSPFKVK VLPTYDASKV TASGPGLSSY GVPASLPVDF AIDARDAGEG LLAVQITDQE
1561 GKPKRAIVHD NKDGTYAVTY IPDKTGRYMI GVTYGGDDIP LSPYRIRATQ TGDASKCLAT
1621 GPGIASTVKT GEEVGFVVDA KTAGKGKVTC TVLTPDGTEA EADVIENEDG TYDIFYTAAK
1681 PGTYVIYVRF GGVDIPNSPF TVMATDGEVT AVEEAPVNAC PPGFRPWVTE EAYVPVSDMN
1741 GLGFKPFDLV IPFAVRKGEI TGEVHMPSGK TATPEIVDNK DGTVTVRYAP TEVGLHEMHI
1801 KYMGSHIPES PLQFYVNYPN SGSVSAYGPG LVYGVANKTA TFTIVTEDAG EGGLDLAIEG
1861 PSKAEISCID NKDGTCTVTY LPTLPGDYSI LVKYNDKHIP GSPFTAKITD DSRRCSQVKL
1921 GSAADFLLDI SETDLSSLTA SIKAPSGRDE PCLLKRLPNN HIGISFIPRE VGEHLVSIKK
1981 NGNHVANSPV SIMVVQSEIG DARRAKVYGR GLSEGRTFEM SDFIVDTRDA GYGGISLAVE
2041 GPSKVDIQTE DLEDGTCKVS YFPTVPGVYI VSTKFADEHV PGSPFTVKIS GEGRVKESIT
2101 RTSRAPSVAT VGSICDLNLK IPEINSSDMS AHVTSPSGRV TEAEIVPMGK NSHCVRFVPQ
2161 EMGVHTVSVK YRGQHVTGSP FQFTVGPLGE GGAHKVRAGG PGLERGEAGV PAEFSIWTRE
2221 AGAGGLSIAV EGPSKAEITF DDHKNGSCGV SYIAQEPGNY EVSIKFNDEH IPESPYLVPV
2281 IAPSDDARRL TVMSLQESGL KVNQPASFAI RLNGAKGKID AKVHSPSGAV EECHVSELEP
2341 DKYAVRFIPH ENGVHTIDVK FNGSHVVGSP FKVRVGEPGQ AGNPALVSAY GTGLEGGTTG
2401 IQSEFFINTT RAGPGTLSVT IEGPSKVKMD CQETPEGYKV MYTPMAPGNY LISVKYGGPN
2461 HIVGSPFKAK VTGQRLVSPG SANETSSILV ESVTRSSTET CYSAIPKASS DASKVTSKGA
2521 GLSKAFVGQK SSFLVDCSKA GSNMLLIGVH GPTTPCEEVS MKHVGNQQYN VTYVVKERGD
2581 YVLAVKWGEE HIPGSPFHVT VP*

Effects on Restriction sites

Raw variant Created Deleted
1 BsaXI (2), BssSI, EaeI, MscI ApeKI, BbvI, Fnu4HI, TseI

Experimental services

Genomic description: 3271_3272delinsTG

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 457 -165 292
2 458 706 293 541
3 707 804 542 639
4 805 952 640 787
5 953 1071 788 906
6 1072 1149 907 984
7 1150 1312 985 1147
8 1313 1510 1148 1345
9 1511 1648 1346 1483
10 1649 1775 1484 1610
11 1776 1912 1611 1747
12 1913 2106 1748 1941
13 2107 2220 1942 2055
14 2221 2364 2056 2199
15 2365 2488 2200 2323
16 2489 2649 2324 2484
17 2650 2740 2485 2575
18 2741 2910 2576 2745
19 2911 3028 2746 2863
20 3029 3291 2864 3126
21 3292 3889 3127 3724
22 3890 4063 3725 3898
23 4064 4226 3899 4061
24 4227 4387 4062 4222
25 4388 4555 4223 4390
26 4556 4679 4391 4514
27 4680 4836 4515 4671
28 4837 5026 4672 4861
29 5027 5274 4862 5109
30 5275 5346 5110 5181
31 5347 5449 5182 5284
32 5450 5590 5285 5425
33 5591 5719 5426 5554
34 5720 5893 5555 5728
35 5894 6052 5729 5887
36 6053 6256 5888 6091
37 6257 6409 6092 6244
38 6410 6532 6245 6367
39 6533 6799 6368 6634
40 6800 6937 6635 6772
41 6938 7053 6773 6888
42 7054 7186 6889 7021
43 7187 7363 7022 7198
44 7364 7582 7199 7417
45 7583 7786 7418 7621
46 7787 9467 7622 *1493

CDS information

g. c.
Start 166 1
Stop 7974 7809

Links

Download this reference sequence file: NM_001457.3.gb


Name ID Locus tag Product Link method
FLNB_v001 NM_001457.3 exhaustion
FLNB_i001 NP_001448.2 filamin-B isoform 2 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.