Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: delins from 695 to 698

GGCCATCATGATCAGTGTCATTGTC ATTA TGACCATCCTCCTGGTGGTCCTGTA
GGCCATCATGATCAGTGTCATTGTC GTTG TGACCATCCTCCTGGTGGTCCTGTA

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_001362271.1:n.695_698delinsGTTG

Affected transcripts - 1

Affected proteins - 1

NM_001362271.1(Psen1_i001):p.(Ile145_Met146delinsValVal)

Reference protein

  1  MTEIPAPLSY FQNAQMSEDS HSSSAIRSQN DSQERQQQHD RQRLDNPEPI SNGRPQSNSR
61 QVVEQDEEED EELTLKYGAK HVIMLFVPVT LCMVVVVATI KSVSFYTRKD GQLIYTPFTE
121 DTETVGQRAL HSILNAAIMI SVIVIMTILL VVLYKYRCYK VIHAWLIISS LLLLFFFSFI
181 YLGEVFKTYN VAVDYVTVAL LIWNFGVVGM IAIHWKGPLR LQQAYLIMIS ALMALVFIKY
241 LPEWTAWLIL AVISVYDLVA VLCPKGPLRM LVETAQERNE TLFPALIYSS TMVWLVNMAE
301 GDPEAQRRVP KNPKYNTQRA ERETQDSGSG NDDGGFSEEW EAQRDSHLGP HRSTPESRAA
361 VQELSGSILT SEDPEERGVK LGLGDFIFYS VLVGKASATA SGDWNTTIAC FVAILIGLCL
421 TLLLLAIFKK ALPALPISIT FGLVFYFATD YLVQPFMDQL AFHQFYI*

Protein predicted from variant coding sequence

  1  MTEIPAPLSY FQNAQMSEDS HSSSAIRSQN DSQERQQQHD RQRLDNPEPI SNGRPQSNSR
61 QVVEQDEEED EELTLKYGAK HVIMLFVPVT LCMVVVVATI KSVSFYTRKD GQLIYTPFTE
121 DTETVGQRAL HSILNAAIMI SVIVVVTILL VVLYKYRCYK VIHAWLIISS LLLLFFFSFI
181 YLGEVFKTYN VAVDYVTVAL LIWNFGVVGM IAIHWKGPLR LQQAYLIMIS ALMALVFIKY
241 LPEWTAWLIL AVISVYDLVA VLCPKGPLRM LVETAQERNE TLFPALIYSS TMVWLVNMAE
301 GDPEAQRRVP KNPKYNTQRA ERETQDSGSG NDDGGFSEEW EAQRDSHLGP HRSTPESRAA
361 VQELSGSILT SEDPEERGVK LGLGDFIFYS VLVGKASATA SGDWNTTIAC FVAILIGLCL
421 TLLLLAIFKK ALPALPISIT FGLVFYFATD YLVQPFMDQL AFHQFYI*

Effects on Restriction sites

Raw variant Created Deleted
1 Tsp45I

Experimental services

Genomic description: [695A>G;698A>G]

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 142 -262 -121
2 143 209 -120 -54
3 210 349 -53 87
4 350 600 88 338
5 601 742 339 480
6 743 810 481 548
7 811 1031 549 769
8 1032 1130 770 868
9 1131 1217 869 955
10 1218 1391 956 1129
11 1392 1510 1130 1248
12 1511 2690 1249 *1024

CDS information

g. c.
Start 263 1
Stop 1666 1404

Links

Download this reference sequence file: NM_001362271.1.gb


Name ID Locus tag Product Link method
Psen1_v001 NM_001362271.1 exhaustion
Psen1_i001 NP_001349200.1 presenilin-1 precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.