Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 726

GACTTGGTACTGAGGAAGGCGCTGT T CAGCACGCTCAAGGAAACAGACACA
GACTTGGTACTGAGGAAGGCGCTGT C CAGCACGCTCAAGGAAACAGACACA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_001270507.1:n.726T>C

Affected transcripts - 1

Affected proteins - 1

NM_001270507.1(TNFAIP3_i001):p.(Phe127Ser)

Reference protein

  1  MAEQVLPQAL YLSNMRKAVK IRERTPEDIF KPTNGIIHHF KTMHRYTLEM FRTCQFCPQF
61 REIIHKALID RNIQATLESQ KKLNWCREVR KLVALKTNGD GNCLMHATSQ YMWGVQDTDL
121 VLRKALFSTL KETDTRNFKF RWQLESLKSQ EFVETGLCYD TRNWNDEWDN LIKMASTDTP
181 MARSGLQYNS LEEIHIFVLC NILRRPIIVI SDKMLRSLES GSNFAPLKVG GIYLPLHWPA
241 QECYRYPIVL GYDSHHFVPL VTLKDSGPEI RAVPLVNRDR GRFEDLKVHF LTDPENEMKE
301 KLLKEYLMVI EIPVQGWDHG TTHLINAAKL DEANLPKEIN LVDDYFELVQ HEYKKWQENS
361 EQGRREGHAQ NPMEPSVPQL SLMDVKCETP NCPFFMSVNT QPLCHECSER RQKNQNKLPK
421 LNSKPGPEGL PGMALGASRG EAYEPLAWNP EESTGGPHSA PPTAPSPFLF SETTAMKCRS
481 PGCPFTLNVQ HNGFCERCHN ARQLHASHAP DHTRHLDPGK CQACLQDVTR TFNGICSTCF
541 KRTTAEASSS LSTSLPPSCH QRSKSDPSRL VRSPSPHSCH RAGNDAPAGC LSQAARTPGD
601 RTGTSKCRKA GCVYFGTPEN KGFCTLCFIE YRENKHFAAA SGKVSPTASR FQNTIPCLGR
661 ECGTLGSTMF EGYCQKCFIE AQNQRFHEAK RTEEQLRSSQ RRDVPRTTQS TSRPKCARAS
721 CKNILACRSE ELCMECQHPN QRMGPGAHRG EPAPEDPPKQ RCRAPACDHF GNAKCNGYCN
781 ECFQFKQMYG *

Protein predicted from variant coding sequence

  1  MAEQVLPQAL YLSNMRKAVK IRERTPEDIF KPTNGIIHHF KTMHRYTLEM FRTCQFCPQF
61 REIIHKALID RNIQATLESQ KKLNWCREVR KLVALKTNGD GNCLMHATSQ YMWGVQDTDL
121 VLRKALSSTL KETDTRNFKF RWQLESLKSQ EFVETGLCYD TRNWNDEWDN LIKMASTDTP
181 MARSGLQYNS LEEIHIFVLC NILRRPIIVI SDKMLRSLES GSNFAPLKVG GIYLPLHWPA
241 QECYRYPIVL GYDSHHFVPL VTLKDSGPEI RAVPLVNRDR GRFEDLKVHF LTDPENEMKE
301 KLLKEYLMVI EIPVQGWDHG TTHLINAAKL DEANLPKEIN LVDDYFELVQ HEYKKWQENS
361 EQGRREGHAQ NPMEPSVPQL SLMDVKCETP NCPFFMSVNT QPLCHECSER RQKNQNKLPK
421 LNSKPGPEGL PGMALGASRG EAYEPLAWNP EESTGGPHSA PPTAPSPFLF SETTAMKCRS
481 PGCPFTLNVQ HNGFCERCHN ARQLHASHAP DHTRHLDPGK CQACLQDVTR TFNGICSTCF
541 KRTTAEASSS LSTSLPPSCH QRSKSDPSRL VRSPSPHSCH RAGNDAPAGC LSQAARTPGD
601 RTGTSKCRKA GCVYFGTPEN KGFCTLCFIE YRENKHFAAA SGKVSPTASR FQNTIPCLGR
661 ECGTLGSTMF EGYCQKCFIE AQNQRFHEAK RTEEQLRSSQ RRDVPRTTQS TSRPKCARAS
721 CKNILACRSE ELCMECQHPN QRMGPGAHRG EPAPEDPPKQ RCRAPACDHF GNAKCNGYCN
781 ECFQFKQMYG *

Effects on Restriction sites

Raw variant Created Deleted
1 LpnPI

Experimental services

Genomic description: 726T>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 331 -346 -16
2 332 641 -15 295
3 642 832 296 486
4 833 980 487 634
5 981 1151 635 805
6 1152 1332 806 986
7 1333 2252 987 1906
8 2253 2434 1907 2088
9 2435 4714 2089 *1995

CDS information

g. c.
Start 347 1
Stop 2719 2373

Links

Download this reference sequence file: NM_001270507.1.gb


Name ID Locus tag Product Link method
TNFAIP3_v001 NM_001270507.1 exhaustion
TNFAIP3_i001 NP_001257436.1 tumor necrosis factor alpha-induced protein 3 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.