Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1224

TCATTAGGCAACATCCATCATAAAC C AGGAGGTGGCCAGGTGGAAGTAAAA
TCATTAGGCAACATCCATCATAAAC T AGGAGGTGGCCAGGTGGAAGTAAAA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_001203252.1:n.1224C>T

Affected transcripts - 1

Affected proteins - 1

NM_001203252.1(MAPT_i001):p.(Pro301Leu)

Reference protein

  1  MAEPRQEFEV MEDHAGTYGL GDRKDQGGYT MHQDQEGDTD AGLKESPLQT PTEDGSEEPG
61 SETSDAKSTP TAEDVTAPLV DEGAPGKQAA AQPHTEIPEG TTAEEAGIGD TPSLEDEAAG
121 HVTQARMVSK SKDGTGSDDK KAKGADGKTK IATPRGAAPP GQKGQANATR IPAKTPPAPK
181 TPPSSGEPPK SGDRSGYSSP GSPGTPGSRS RTPSLPTPPT REPKKVAVVR TPPKSPSSAK
241 SRLQTAPVPM PDLKNVKSKI GSTENLKHQP GGGKVQIVYK PVDLSKVTSK CGSLGNIHHK
301 PGGGQVEVKS EKLDFKDRVQ SKIGSLDNIT HVPGGGNKKI ETHKLTFREN AKAKTDHGAE
361 IVYKSPVVSG DTSPRHLSNV SSTGSIDMVD SPQLATLADE VSASLAKQGL *

Protein predicted from variant coding sequence

  1  MAEPRQEFEV MEDHAGTYGL GDRKDQGGYT MHQDQEGDTD AGLKESPLQT PTEDGSEEPG
61 SETSDAKSTP TAEDVTAPLV DEGAPGKQAA AQPHTEIPEG TTAEEAGIGD TPSLEDEAAG
121 HVTQARMVSK SKDGTGSDDK KAKGADGKTK IATPRGAAPP GQKGQANATR IPAKTPPAPK
181 TPPSSGEPPK SGDRSGYSSP GSPGTPGSRS RTPSLPTPPT REPKKVAVVR TPPKSPSSAK
241 SRLQTAPVPM PDLKNVKSKI GSTENLKHQP GGGKVQIVYK PVDLSKVTSK CGSLGNIHHK
301 LGGGQVEVKS EKLDFKDRVQ SKIGSLDNIT HVPGGGNKKI ETHKLTFREN AKAKTDHGAE
361 IVYKSPVVSG DTSPRHLSNV SSTGSIDMVD SPQLATLADE VSASLAKQGL *

Effects on Restriction sites

Raw variant Created Deleted
1 BfaI BslI, PflMI

Experimental services

Genomic description: 1224C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 305 -322 -18
2 306 455 -17 133
3 456 542 134 220
4 543 629 221 307
5 630 695 308 373
6 696 751 374 429
7 752 878 430 556
8 879 1144 557 822
9 1145 1226 823 904
10 1227 1339 905 1017
11 1340 5718 1018 *4163

CDS information

g. c.
Start 323 1
Stop 1555 1233

Links

Download this reference sequence file: NM_001203252.1.gb


Name ID Locus tag Product Link method
MAPT_v001 NM_001203252.1 exhaustion
MAPT_i001 NP_001190181.1 microtubule-associated protein tau isoform 8 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.