Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 105

GCTCTGGCTCTTCTTTCAGCGTTTT C GGCCACCCAGGCACGGAAAGGCTTC
GCTCTGGCTCTTCTTTCAGCGTTTT T GGCCACCCAGGCACGGAAAGGCTTC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_001166598.1:n.105C>T

Affected transcripts - 1

Affected proteins - 1

NM_001166598.1(APOA5_i001):p.(Ser19Leu)

Reference protein

  1  MASMAAVLTW ALALLSAFSA TQARKGFWDY FSQTSGDKGR VEQIHQQKMA REPATLKDSL
61 EQDLNNMNKF LEKLRPLSGS EAPRLPQDPV GMRRQLQEEL EEVKARLQPY MAEAHELVGW
121 NLEGLRQQLK PYTMDLMEQV ALRVQELQEQ LRVVGEDTKA QLLGGVDEAW ALLQGLQSRV
181 VHHTGRFKEL FHPYAESLVS GIGRHVQELH RSVAPHAPAS PARLSRCVQV LSRKLTLKAK
241 ALHARIQQNL DQLREELSRA FAGTGTEEGA GPDPQMLSEE VRQRLQAFRQ DTYLQIAAFT
301 RAIDQETEEV QQQLAPPPPG HSAFAPEFQQ TDSGKVLSKL QARLDDLWED ITHSLHDQGH
361 SHLGDP*

Protein predicted from variant coding sequence

  1  MASMAAVLTW ALALLSAFLA TQARKGFWDY FSQTSGDKGR VEQIHQQKMA REPATLKDSL
61 EQDLNNMNKF LEKLRPLSGS EAPRLPQDPV GMRRQLQEEL EEVKARLQPY MAEAHELVGW
121 NLEGLRQQLK PYTMDLMEQV ALRVQELQEQ LRVVGEDTKA QLLGGVDEAW ALLQGLQSRV
181 VHHTGRFKEL FHPYAESLVS GIGRHVQELH RSVAPHAPAS PARLSRCVQV LSRKLTLKAK
241 ALHARIQQNL DQLREELSRA FAGTGTEEGA GPDPQMLSEE VRQRLQAFRQ DTYLQIAAFT
301 RAIDQETEEV QQQLAPPPPG HSAFAPEFQQ TDSGKVLSKL QARLDDLWED ITHSLHDQGH
361 SHLGDP*

Effects on Restriction sites

Raw variant Created Deleted
1 MscI

Experimental services

Genomic description: 105C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 41 -49 -9
2 42 98 -8 49
3 99 210 50 161
4 211 1908 162 *758

CDS information

g. c.
Start 50 1
Stop 1150 1101

Links

Download this reference sequence file: NM_001166598.1.gb


Name ID Locus tag Product Link method
APOA5_v001 NM_001166598.1 exhaustion
APOA5_i001 NP_001160070.1 apolipoprotein A-V precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.