Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 2229

TCAAAGGATAATATCAAACACGTCC C GGGAGGCGGCAGTGTGCAAATAGTC
TCAAAGGATAATATCAAACACGTCC T GGGAGGCGGCAGTGTGCAAATAGTC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_001123066.3:n.2229C>T

Affected transcripts - 1

Affected proteins - 1

NM_001123066.3(MAPT_i001):p.(Pro636Leu)

Reference protein

  1  MAEPRQEFEV MEDHAGTYGL GDRKDQGGYT MHQDQEGDTD AGLKESPLQT PTEDGSEEPG
61 SETSDAKSTP TAEDVTAPLV DEGAPGKQAA AQPHTEIPEG TTAEEAGIGD TPSLEDEAAG
121 HVTQEPESGK VVQEGFLREP GPPGLSHQLM SGMPGAPLLP EGPREATRQP SGTGPEDTEG
181 GRHAPELLKH QLLGDLHQEG PPLKGAGGKE RPGSKEEVDE DRDVDESSPQ DSPPSKASPA
241 QDGRPPQTAA REATSIPGFP AEGAIPLPVD FLSKVSTEIP ASEPDGPSVG RAKGQDAPLE
301 FTFHVEITPN VQKEQAHSEE HLGRAAFPGA PGEGPEARGP SLGEDTKEAD LPEPSEKQPA
361 AAPRGKPVSR VPQLKARMVS KSKDGTGSDD KKAKTSTRSS AKTLKNRPCL SPKHPTPGSS
421 DPLIQPSSPA VCPEPPSSPK YVSSVTSRTG SSGAKEMKLK GADGKTKIAT PRGAAPPGQK
481 GQANATRIPA KTPPAPKTPP SSATKQVQRR PPPAGPRSER GEPPKSGDRS GYSSPGSPGT
541 PGSRSRTPSL PTPPTREPKK VAVVRTPPKS PSSAKSRLQT APVPMPDLKN VKSKIGSTEN
601 LKHQPGGGKV QIINKKLDLS NVQSKCGSKD NIKHVPGGGS VQIVYKPVDL SKVTSKCGSL
661 GNIHHKPGGG QVEVKSEKLD FKDRVQSKIG SLDNITHVPG GGNKKIETHK LTFRENAKAK
721 TDHGAEIVYK SPVVSGDTSP RHLSNVSSTG SIDMVDSPQL ATLADEVSAS LAKQGL*

Protein predicted from variant coding sequence

  1  MAEPRQEFEV MEDHAGTYGL GDRKDQGGYT MHQDQEGDTD AGLKESPLQT PTEDGSEEPG
61 SETSDAKSTP TAEDVTAPLV DEGAPGKQAA AQPHTEIPEG TTAEEAGIGD TPSLEDEAAG
121 HVTQEPESGK VVQEGFLREP GPPGLSHQLM SGMPGAPLLP EGPREATRQP SGTGPEDTEG
181 GRHAPELLKH QLLGDLHQEG PPLKGAGGKE RPGSKEEVDE DRDVDESSPQ DSPPSKASPA
241 QDGRPPQTAA REATSIPGFP AEGAIPLPVD FLSKVSTEIP ASEPDGPSVG RAKGQDAPLE
301 FTFHVEITPN VQKEQAHSEE HLGRAAFPGA PGEGPEARGP SLGEDTKEAD LPEPSEKQPA
361 AAPRGKPVSR VPQLKARMVS KSKDGTGSDD KKAKTSTRSS AKTLKNRPCL SPKHPTPGSS
421 DPLIQPSSPA VCPEPPSSPK YVSSVTSRTG SSGAKEMKLK GADGKTKIAT PRGAAPPGQK
481 GQANATRIPA KTPPAPKTPP SSATKQVQRR PPPAGPRSER GEPPKSGDRS GYSSPGSPGT
541 PGSRSRTPSL PTPPTREPKK VAVVRTPPKS PSSAKSRLQT APVPMPDLKN VKSKIGSTEN
601 LKHQPGGGKV QIINKKLDLS NVQSKCGSKD NIKHVLGGGS VQIVYKPVDL SKVTSKCGSL
661 GNIHHKPGGG QVEVKSEKLD FKDRVQSKIG SLDNITHVPG GGNKKIETHK LTFRENAKAK
721 TDHGAEIVYK SPVVSGDTSP RHLSNVSSTG SIDMVDSPQL ATLADEVSAS LAKQGL*

Effects on Restriction sites

Raw variant Created Deleted
1 BstNI, PspGI AvaI, BslI, BsmFI, BsoBI, HpaII, MspI, NciI (2), SmaI, TspMI, XmaI

Experimental services

Genomic description: 2229C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 305 -322 -18
2 306 455 -17 133
3 456 542 134 220
4 543 629 221 307
5 630 695 308 373
6 696 1448 374 1126
7 1449 1504 1127 1182
8 1505 1702 1183 1380
9 1703 1829 1381 1507
10 1830 1883 1508 1561
11 1884 2149 1562 1827
12 2150 2242 1828 1920
13 2243 2324 1921 2002
14 2325 2437 2003 2115
15 2438 6816 2116 *4163

CDS information

g. c.
Start 323 1
Stop 2653 2331

Links

Download this reference sequence file: NM_001123066.3.gb


Name ID Locus tag Product Link method
MAPT_v001 NM_001123066.3 exhaustion
MAPT_i001 NP_001116538.2 microtubule-associated protein tau isoform 6 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.