Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: deletion of 1724 to 1742

GCTATGTTTAACTTGGATAACTTCC CCGACTGGGCAAATTCAAC AAGTGTTAACACTTAGGAAGAGCCG
GCTATGTTTAACTTGGATAACTTCC ------------------- AAGTGTTAACACTTAGGAAGAGCCG

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_001004148.4:n.1724_1742del

Affected transcripts - 1

Affected proteins - 1

NM_001004148.4(Slc13a5_i001):p.(Pro562Glnfs*22)

Reference protein

  1  MDSAKTCVTK FKSFAILLFT PILMLPLVIL IPDKFARCAY VIVIMAVYWC TDVIPVAVTS
61 LLPVLLFPLL KVLDSKQVCI QYMKDTNMLF LGSLIVAVAV ERWKLHKRVA LRMLLFVGTK
121 PSRLMLGFMF VTAFLSMWIS NTAATAMMIP IVEAMLQQMI AANTAVEASL GTLELLDKNK
181 TSELPGSQVV FEDPNVQEQE DEETKNMYKA MHLCVCYSAS IGGTATLTGT GPNVVLLGQM
241 QELFPDSKDV LNYASWFGFA FPNMVMMLVL AWLWLQCLYM RHNLKKTCIC CGEKKRDTEK
301 IAYKVLNEEY QKLGSLSYPE CNVLFCFTLL VILWFSRDPG FMPGWLSFAW VEGNTVHITD
361 ATVAIFVAIL LFIIPSQKPK FNFSSQTEEE RKTPFYPPAL LDWKVAQEKV PWDIVLLLGG
421 GFAMAKGCET SGLSKWMAAQ MEPLRLVKPA VITLILSCLV AMTTECTSNV ATTTLFLPIF
481 ASMARSIGIH PLYVMIPCTM SASLAFMLPV ATPPNAIVFA YGHLRVVDMM KTGLIMNFVG
541 ILSVFLSVNT WGRAMFNLDN FPDWANSTSV NT*

Protein predicted from variant coding sequence

  1  MDSAKTCVTK FKSFAILLFT PILMLPLVIL IPDKFARCAY VIVIMAVYWC TDVIPVAVTS
61 LLPVLLFPLL KVLDSKQVCI QYMKDTNMLF LGSLIVAVAV ERWKLHKRVA LRMLLFVGTK
121 PSRLMLGFMF VTAFLSMWIS NTAATAMMIP IVEAMLQQMI AANTAVEASL GTLELLDKNK
181 TSELPGSQVV FEDPNVQEQE DEETKNMYKA MHLCVCYSAS IGGTATLTGT GPNVVLLGQM
241 QELFPDSKDV LNYASWFGFA FPNMVMMLVL AWLWLQCLYM RHNLKKTCIC CGEKKRDTEK
301 IAYKVLNEEY QKLGSLSYPE CNVLFCFTLL VILWFSRDPG FMPGWLSFAW VEGNTVHITD
361 ATVAIFVAIL LFIIPSQKPK FNFSSQTEEE RKTPFYPPAL LDWKVAQEKV PWDIVLLLGG
421 GFAMAKGCET SGLSKWMAAQ MEPLRLVKPA VITLILSCLV AMTTECTSNV ATTTLFLPIF
481 ASMARSIGIH PLYVMIPCTM SASLAFMLPV ATPPNAIVFA YGHLRVVDMM KTGLIMNFVG
541 ILSVFLSVNT WGRAMFNLDN FQVLTLRKSR KSTSMPPPPQ PF*

Effects on Restriction sites

Raw variant Created Deleted
1 ApoI, BmrI, BslI, BsrI, LpnPI, MluCI

Experimental services

Genomic description: 1724_1742del

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 141 -39 102
2 142 270 103 231
3 271 407 232 368
4 408 595 369 556
5 596 764 557 725
6 765 887 726 848
7 888 1106 849 1067
8 1107 1207 1068 1168
9 1208 1326 1169 1287
10 1327 1488 1288 1449
11 1489 1626 1450 1587
12 1627 3269 1588 *1511

CDS information

g. c.
Start 40 1
Stop 1758 1719

Links

Download this reference sequence file: NM_001004148.4.gb


Name ID Locus tag Product Link method
Slc13a5_v001 NM_001004148.4 exhaustion
Slc13a5_i001 NP_001004148.1 solute carrier family 13 member 5 isoform 1 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.