Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1784

GAAGGTGGAATCACACTGAGTGGAG G TCAACGAGCAAGAATTTCTTTAGCA
GAAGGTGGAATCACACTGAGTGGAG A TCAACGAGCAAGAATTTCTTTAGCA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000492.3:n.1784G>A

Affected transcripts - 1

Affected proteins - 1

NM_000492.3(CFTR_i001):p.(Gly551Asp)

Reference protein

   1  MQRSPLEKAS VVSKLFFSWT RPILRKGYRQ RLELSDIYQI PSVDSADNLS EKLEREWDRE
61 LASKKNPKLI NALRRCFFWR FMFYGIFLYL GEVTKAVQPL LLGRIIASYD PDNKEERSIA
121 IYLGIGLCLL FIVRTLLLHP AIFGLHHIGM QMRIAMFSLI YKKTLKLSSR VLDKISIGQL
181 VSLLSNNLNK FDEGLALAHF VWIAPLQVAL LMGLIWELLQ ASAFCGLGFL IVLALFQAGL
241 GRMMMKYRDQ RAGKISERLV ITSEMIENIQ SVKAYCWEEA MEKMIENLRQ TELKLTRKAA
301 YVRYFNSSAF FFSGFFVVFL SVLPYALIKG IILRKIFTTI SFCIVLRMAV TRQFPWAVQT
361 WYDSLGAINK IQDFLQKQEY KTLEYNLTTT EVVMENVTAF WEEGFGELFE KAKQNNNNRK
421 TSNGDDSLFF SNFSLLGTPV LKDINFKIER GQLLAVAGST GAGKTSLLMV IMGELEPSEG
481 KIKHSGRISF CSQFSWIMPG TIKENIIFGV SYDEYRYRSV IKACQLEEDI SKFAEKDNIV
541 LGEGGITLSG GQRARISLAR AVYKDADLYL LDSPFGYLDV LTEKEIFESC VCKLMANKTR
601 ILVTSKMEHL KKADKILILH EGSSYFYGTF SELQNLQPDF SSKLMGCDSF DQFSAERRNS
661 ILTETLHRFS LEGDAPVSWT ETKKQSFKQT GEFGEKRKNS ILNPINSIRK FSIVQKTPLQ
721 MNGIEEDSDE PLERRLSLVP DSEQGEAILP RISVISTGPT LQARRRQSVL NLMTHSVNQG
781 QNIHRKTTAS TRKVSLAPQA NLTELDIYSR RLSQETGLEI SEEINEEDLK ECFFDDMESI
841 PAVTTWNTYL RYITVHKSLI FVLIWCLVIF LAEVAASLVV LWLLGNTPLQ DKGNSTHSRN
901 NSYAVIITST SSYYVFYIYV GVADTLLAMG FFRGLPLVHT LITVSKILHH KMLHSVLQAP
961 MSTLNTLKAG GILNRFSKDI AILDDLLPLT IFDFIQLLLI VIGAIAVVAV LQPYIFVATV
1021 PVIVAFIMLR AYFLQTSQQL KQLESEGRSP IFTHLVTSLK GLWTLRAFGR QPYFETLFHK
1081 ALNLHTANWF LYLSTLRWFQ MRIEMIFVIF FIAVTFISIL TTGEGEGRVG IILTLAMNIM
1141 STLQWAVNSS IDVDSLMRSV SRVFKFIDMP TEGKPTKSTK PYKNGQLSKV MIIENSHVKK
1201 DDIWPSGGQM TVKDLTAKYT EGGNAILENI SFSISPGQRV GLLGRTGSGK STLLSAFLRL
1261 LNTEGEIQID GVSWDSITLQ QWRKAFGVIP QKVFIFSGTF RKNLDPYEQW SDQEIWKVAD
1321 EVGLRSVIEQ FPGKLDFVLV DGGCVLSHGH KQLMCLARSV LSKAKILLLD EPSAHLDPVT
1381 YQIIRRTLKQ AFADCTVILC EHRIEAMLEC QQFLVIEENK VRQYDSIQKL LNERSLFRQA
1441 ISPSDRVKLF PHRNSSKCKS KPQIAALKEE TEEEVQDTRL *

Protein predicted from variant coding sequence

   1  MQRSPLEKAS VVSKLFFSWT RPILRKGYRQ RLELSDIYQI PSVDSADNLS EKLEREWDRE
61 LASKKNPKLI NALRRCFFWR FMFYGIFLYL GEVTKAVQPL LLGRIIASYD PDNKEERSIA
121 IYLGIGLCLL FIVRTLLLHP AIFGLHHIGM QMRIAMFSLI YKKTLKLSSR VLDKISIGQL
181 VSLLSNNLNK FDEGLALAHF VWIAPLQVAL LMGLIWELLQ ASAFCGLGFL IVLALFQAGL
241 GRMMMKYRDQ RAGKISERLV ITSEMIENIQ SVKAYCWEEA MEKMIENLRQ TELKLTRKAA
301 YVRYFNSSAF FFSGFFVVFL SVLPYALIKG IILRKIFTTI SFCIVLRMAV TRQFPWAVQT
361 WYDSLGAINK IQDFLQKQEY KTLEYNLTTT EVVMENVTAF WEEGFGELFE KAKQNNNNRK
421 TSNGDDSLFF SNFSLLGTPV LKDINFKIER GQLLAVAGST GAGKTSLLMV IMGELEPSEG
481 KIKHSGRISF CSQFSWIMPG TIKENIIFGV SYDEYRYRSV IKACQLEEDI SKFAEKDNIV
541 LGEGGITLSG DQRARISLAR AVYKDADLYL LDSPFGYLDV LTEKEIFESC VCKLMANKTR
601 ILVTSKMEHL KKADKILILH EGSSYFYGTF SELQNLQPDF SSKLMGCDSF DQFSAERRNS
661 ILTETLHRFS LEGDAPVSWT ETKKQSFKQT GEFGEKRKNS ILNPINSIRK FSIVQKTPLQ
721 MNGIEEDSDE PLERRLSLVP DSEQGEAILP RISVISTGPT LQARRRQSVL NLMTHSVNQG
781 QNIHRKTTAS TRKVSLAPQA NLTELDIYSR RLSQETGLEI SEEINEEDLK ECFFDDMESI
841 PAVTTWNTYL RYITVHKSLI FVLIWCLVIF LAEVAASLVV LWLLGNTPLQ DKGNSTHSRN
901 NSYAVIITST SSYYVFYIYV GVADTLLAMG FFRGLPLVHT LITVSKILHH KMLHSVLQAP
961 MSTLNTLKAG GILNRFSKDI AILDDLLPLT IFDFIQLLLI VIGAIAVVAV LQPYIFVATV
1021 PVIVAFIMLR AYFLQTSQQL KQLESEGRSP IFTHLVTSLK GLWTLRAFGR QPYFETLFHK
1081 ALNLHTANWF LYLSTLRWFQ MRIEMIFVIF FIAVTFISIL TTGEGEGRVG IILTLAMNIM
1141 STLQWAVNSS IDVDSLMRSV SRVFKFIDMP TEGKPTKSTK PYKNGQLSKV MIIENSHVKK
1201 DDIWPSGGQM TVKDLTAKYT EGGNAILENI SFSISPGQRV GLLGRTGSGK STLLSAFLRL
1261 LNTEGEIQID GVSWDSITLQ QWRKAFGVIP QKVFIFSGTF RKNLDPYEQW SDQEIWKVAD
1321 EVGLRSVIEQ FPGKLDFVLV DGGCVLSHGH KQLMCLARSV LSKAKILLLD EPSAHLDPVT
1381 YQIIRRTLKQ AFADCTVILC EHRIEAMLEC QQFLVIEENK VRQYDSIQKL LNERSLFRQA
1441 ISPSDRVKLF PHRNSSKCKS KPQIAALKEE TEEEVQDTRL *

Effects on Restriction sites

Raw variant Created Deleted
1 DpnI, DpnII, MboI, Sau3AI HincII, Hpy166II, MnlI

Experimental services

Genomic description: 1784G>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 185 -132 53
2 186 296 54 164
3 297 405 165 273
4 406 621 274 489
5 622 711 490 579
6 712 875 580 743
7 876 1001 744 869
8 1002 1248 870 1116
9 1249 1341 1117 1209
10 1342 1524 1210 1392
11 1525 1716 1393 1584
12 1717 1811 1585 1679
13 1812 1898 1680 1766
14 1899 2622 1767 2490
15 2623 2751 2491 2619
16 2752 2789 2620 2657
17 2790 3040 2658 2908
18 3041 3120 2909 2988
19 3121 3271 2989 3139
20 3272 3499 3140 3367
21 3500 3600 3368 3468
22 3601 3849 3469 3717
23 3850 4005 3718 3873
24 4006 4095 3874 3963
25 4096 4268 3964 4136
26 4269 4374 4137 4242
27 4375 6132 4243 *1557

CDS information

g. c.
Start 133 1
Stop 4575 4443

Links

Download this reference sequence file: NM_000492.3.gb


Name ID Locus tag Product Link method
CFTR_v001 NM_000492.3 exhaustion
CFTR_i001 NP_000483.3 cystic fibrosis transmembrane conductance regulator exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.