Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


The given DelIns is actually an inversion.

0 Errors, 1 Warning.


Overview of the raw variants

Raw variant 1: inversion between 2160 and 2161

AGACGGAGGAGATCTCTGAAGTGAA GA TGGATGCAGAATTCCGACATGACTC
AGACGGAGGAGATCTCTGAAGTGAA TC TGGATGCAGAATTCCGACATGACTC

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000484.4:n.2160_2161inv

Affected transcripts - 1

Affected proteins - 1

NM_000484.4(APP_i001):p.(Lys670_Met671delinsAsnLeu)

Reference protein

  1  MLPGLALLLL AAWTARALEV PTDGNAGLLA EPQIAMFCGR LNMHMNVQNG KWDSDPSGTK
61 TCIDTKEGIL QYCQEVYPEL QITNVVEANQ PVTIQNWCKR GRKQCKTHPH FVIPYRCLVG
121 EFVSDALLVP DKCKFLHQER MDVCETHLHW HTVAKETCSE KSTNLHDYGM LLPCGIDKFR
181 GVEFVCCPLA EESDNVDSAD AEEDDSDVWW GGADTDYADG SEDKVVEVAE EEEVAEVEEE
241 EADDDEDDED GDEVEEEAEE PYEEATERTT SIATTTTTTT ESVEEVVREV CSEQAETGPC
301 RAMISRWYFD VTEGKCAPFF YGGCGGNRNN FDTEEYCMAV CGSAMSQSLL KTTQEPLARD
361 PVKLPTTAAS TPDAVDKYLE TPGDENEHAH FQKAKERLEA KHRERMSQVM REWEEAERQA
421 KNLPKADKKA VIQHFQEKVE SLEQEAANER QQLVETHMAR VEAMLNDRRR LALENYITAL
481 QAVPPRPRHV FNMLKKYVRA EQKDRQHTLK HFEHVRMVDP KKAAQIRSQV MTHLRVIYER
541 MNQSLSLLYN VPAVAEEIQD EVDELLQKEQ NYSDDVLANM ISEPRISYGN DALMPSLTET
601 KTTVELLPVN GEFSLDDLQP WHSFGADSVP ANTENEVEPV DARPAADRGL TTRPGSGLTN
661 IKTEEISEVK MDAEFRHDSG YEVHHQKLVF FAEDVGSNKG AIIGLMVGGV VIATVIVITL
721 VMLKKKQYTS IHHGVVEVDA AVTPEERHLS KMQQNGYENP TYKFFEQMQN *

Protein predicted from variant coding sequence

  1  MLPGLALLLL AAWTARALEV PTDGNAGLLA EPQIAMFCGR LNMHMNVQNG KWDSDPSGTK
61 TCIDTKEGIL QYCQEVYPEL QITNVVEANQ PVTIQNWCKR GRKQCKTHPH FVIPYRCLVG
121 EFVSDALLVP DKCKFLHQER MDVCETHLHW HTVAKETCSE KSTNLHDYGM LLPCGIDKFR
181 GVEFVCCPLA EESDNVDSAD AEEDDSDVWW GGADTDYADG SEDKVVEVAE EEEVAEVEEE
241 EADDDEDDED GDEVEEEAEE PYEEATERTT SIATTTTTTT ESVEEVVREV CSEQAETGPC
301 RAMISRWYFD VTEGKCAPFF YGGCGGNRNN FDTEEYCMAV CGSAMSQSLL KTTQEPLARD
361 PVKLPTTAAS TPDAVDKYLE TPGDENEHAH FQKAKERLEA KHRERMSQVM REWEEAERQA
421 KNLPKADKKA VIQHFQEKVE SLEQEAANER QQLVETHMAR VEAMLNDRRR LALENYITAL
481 QAVPPRPRHV FNMLKKYVRA EQKDRQHTLK HFEHVRMVDP KKAAQIRSQV MTHLRVIYER
541 MNQSLSLLYN VPAVAEEIQD EVDELLQKEQ NYSDDVLANM ISEPRISYGN DALMPSLTET
601 KTTVELLPVN GEFSLDDLQP WHSFGADSVP ANTENEVEPV DARPAADRGL TTRPGSGLTN
661 IKTEEISEVN LDAEFRHDSG YEVHHQKLVF FAEDVGSNKG AIIGLMVGGV VIATVIVITL
721 VMLKKKQYTS IHHGVVEVDA AVTPEERHLS KMQQNGYENP TYKFFEQMQN *

Effects on Restriction sites

Raw variant Created Deleted
1 Hpy188III, LpnPI, TfiI BccI, MboII

Experimental services

Genomic description: 2160_2161inv

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 207 -150 57
2 208 375 58 225
3 376 505 226 355
4 506 618 356 468
5 619 812 469 662
6 813 1015 663 865
7 1016 1183 866 1033
8 1184 1240 1034 1090
9 1241 1374 1091 1224
10 1375 1449 1225 1299
11 1450 1608 1300 1458
12 1609 1737 1459 1587
13 1738 1837 1588 1687
14 1838 2059 1688 1909
15 2060 2113 1910 1963
16 2114 2214 1964 2064
17 2215 2361 2065 2211
18 2362 3583 2212 *1120

CDS information

g. c.
Start 151 1
Stop 2463 2313

Links

Download this reference sequence file: NM_000484.4.gb


Name ID Locus tag Product Link method
APP_v001 NM_000484.4 exhaustion
APP_i001 NP_000475.1 amyloid-beta precursor protein isoform a precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.