Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 2211

GACGGAGGAGATCTCTGAAGTGAAG A TGGATGCAGAATTCCGACATGACTC
GACGGAGGAGATCTCTGAAGTGAAG T TGGATGCAGAATTCCGACATGACTC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000484.3:n.2211A>T

Affected transcripts - 1

Affected proteins - 1

NM_000484.3(APP_i001):p.(Met671Leu)

Reference protein

  1  MLPGLALLLL AAWTARALEV PTDGNAGLLA EPQIAMFCGR LNMHMNVQNG KWDSDPSGTK
61 TCIDTKEGIL QYCQEVYPEL QITNVVEANQ PVTIQNWCKR GRKQCKTHPH FVIPYRCLVG
121 EFVSDALLVP DKCKFLHQER MDVCETHLHW HTVAKETCSE KSTNLHDYGM LLPCGIDKFR
181 GVEFVCCPLA EESDNVDSAD AEEDDSDVWW GGADTDYADG SEDKVVEVAE EEEVAEVEEE
241 EADDDEDDED GDEVEEEAEE PYEEATERTT SIATTTTTTT ESVEEVVREV CSEQAETGPC
301 RAMISRWYFD VTEGKCAPFF YGGCGGNRNN FDTEEYCMAV CGSAMSQSLL KTTQEPLARD
361 PVKLPTTAAS TPDAVDKYLE TPGDENEHAH FQKAKERLEA KHRERMSQVM REWEEAERQA
421 KNLPKADKKA VIQHFQEKVE SLEQEAANER QQLVETHMAR VEAMLNDRRR LALENYITAL
481 QAVPPRPRHV FNMLKKYVRA EQKDRQHTLK HFEHVRMVDP KKAAQIRSQV MTHLRVIYER
541 MNQSLSLLYN VPAVAEEIQD EVDELLQKEQ NYSDDVLANM ISEPRISYGN DALMPSLTET
601 KTTVELLPVN GEFSLDDLQP WHSFGADSVP ANTENEVEPV DARPAADRGL TTRPGSGLTN
661 IKTEEISEVK MDAEFRHDSG YEVHHQKLVF FAEDVGSNKG AIIGLMVGGV VIATVIVITL
721 VMLKKKQYTS IHHGVVEVDA AVTPEERHLS KMQQNGYENP TYKFFEQMQN *

Protein predicted from variant coding sequence

  1  MLPGLALLLL AAWTARALEV PTDGNAGLLA EPQIAMFCGR LNMHMNVQNG KWDSDPSGTK
61 TCIDTKEGIL QYCQEVYPEL QITNVVEANQ PVTIQNWCKR GRKQCKTHPH FVIPYRCLVG
121 EFVSDALLVP DKCKFLHQER MDVCETHLHW HTVAKETCSE KSTNLHDYGM LLPCGIDKFR
181 GVEFVCCPLA EESDNVDSAD AEEDDSDVWW GGADTDYADG SEDKVVEVAE EEEVAEVEEE
241 EADDDEDDED GDEVEEEAEE PYEEATERTT SIATTTTTTT ESVEEVVREV CSEQAETGPC
301 RAMISRWYFD VTEGKCAPFF YGGCGGNRNN FDTEEYCMAV CGSAMSQSLL KTTQEPLARD
361 PVKLPTTAAS TPDAVDKYLE TPGDENEHAH FQKAKERLEA KHRERMSQVM REWEEAERQA
421 KNLPKADKKA VIQHFQEKVE SLEQEAANER QQLVETHMAR VEAMLNDRRR LALENYITAL
481 QAVPPRPRHV FNMLKKYVRA EQKDRQHTLK HFEHVRMVDP KKAAQIRSQV MTHLRVIYER
541 MNQSLSLLYN VPAVAEEIQD EVDELLQKEQ NYSDDVLANM ISEPRISYGN DALMPSLTET
601 KTTVELLPVN GEFSLDDLQP WHSFGADSVP ANTENEVEPV DARPAADRGL TTRPGSGLTN
661 IKTEEISEVK LDAEFRHDSG YEVHHQKLVF FAEDVGSNKG AIIGLMVGGV VIATVIVITL
721 VMLKKKQYTS IHHGVVEVDA AVTPEERHLS KMQQNGYENP TYKFFEQMQN *

Effects on Restriction sites

Raw variant Created Deleted
1 MmeI BccI, MboII

Experimental services

Genomic description: 2211A>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 257 -200 57
2 258 425 58 225
3 426 555 226 355
4 556 668 356 468
5 669 862 469 662
6 863 1065 663 865
7 1066 1233 866 1033
8 1234 1290 1034 1090
9 1291 1424 1091 1224
10 1425 1499 1225 1299
11 1500 1658 1300 1458
12 1659 1787 1459 1587
13 1788 1887 1588 1687
14 1888 2109 1688 1909
15 2110 2163 1910 1963
16 2164 2264 1964 2064
17 2265 2411 2065 2211
18 2412 3633 2212 *1120

CDS information

g. c.
Start 201 1
Stop 2513 2313

Links

Download this reference sequence file: NM_000484.3.gb


Name ID Locus tag Product Link method
APP_v001 NM_000484.3 exhaustion
APP_i001 NP_000475.1 amyloid-beta A4 protein isoform a precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.