Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 3593

GACTTGTGCAGAACTCTACGAGAAG C TGCCCCAGGGCTACAGACTGGAGAA
GACTTGTGCAGAACTCTACGAGAAG T TGCCCCAGGGCTACAGACTGGAGAA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000459.3:n.3593C>T

Affected transcripts - 1

Affected proteins - 1

NM_000459.3(TEK_i001):p.(=)

Reference protein

   1  MDSLASLVLC GVSLLLSGTV EGAMDLILIN SLPLVSDAET SLTCIASGWR PHEPITIGRD
61 FEALMNQHQD PLEVTQDVTR EWAKKVVWKR EKASKINGAY FCEGRVRGEA IRIRTMKMRQ
121 QASFLPATLT MTVDKGDNVN ISFKKVLIKE EDAVIYKNGS FIHSVPRHEV PDILEVHLPH
181 AQPQDAGVYS ARYIGGNLFT SAFTRLIVRR CEAQKWGPEC NHLCTACMNN GVCHEDTGEC
241 ICPPGFMGRT CEKACELHTF GRTCKERCSG QEGCKSYVFC LPDPYGCSCA TGWKGLQCNE
301 ACHPGFYGPD CKLRCSCNNG EMCDRFQGCL CSPGWQGLQC EREGIPRMTP KIVDLPDHIE
361 VNSGKFNPIC KASGWPLPTN EEMTLVKPDG TVLHPKDFNH TDHFSVAIFT IHRILPPDSG
421 VWVCSVNTVA GMVEKPFNIS VKVLPKPLNA PNVIDTGHNF AVINISSEPY FGDGPIKSKK
481 LLYKPVNHYE AWQHIQVTNE IVTLNYLEPR TEYELCVQLV RRGEGGEGHP GPVRRFTTAS
541 IGLPPPRGLN LLPKSQTTLN LTWQPIFPSS EDDFYVEVER RSVQKSDQQN IKVPGNLTSV
601 LLNNLHPREQ YVVRARVNTK AQGEWSEDLT AWTLSDILPP QPENIKISNI THSSAVISWT
661 ILDGYSISSI TIRYKVQGKN EDQHVDVKIK NATITQYQLK GLEPETAYQV DIFAENNIGS
721 SNPAFSHELV TLPESQAPAD LGGGKMLLIA ILGSAGMTCL TVLLAFLIIL QLKRANVQRR
781 MAQAFQNVRE EPAVQFNSGT LALNRKVKNN PDPTIYPVLD WNDIKFQDVI GEGNFGQVLK
841 ARIKKDGLRM DAAIKRMKEY ASKDDHRDFA GELEVLCKLG HHPNIINLLG ACEHRGYLYL
901 AIEYAPHGNL LDFLRKSRVL ETDPAFAIAN STASTLSSQQ LLHFAADVAR GMDYLSQKQF
961 IHRDLAARNI LVGENYVAKI ADFGLSRGQE VYVKKTMGRL PVRWMAIESL NYSVYTTNSD
1021 VWSYGVLLWE IVSLGGTPYC GMTCAELYEK LPQGYRLEKP LNCDDEVYDL MRQCWREKPY
1081 ERPSFAQILV SLNRMLEERK TYVNTTLYEK FTYAGIDCSA EEAA*

Protein predicted from variant coding sequence

No change: predicted protein (not shown) equals reference protein.

Effects on Restriction sites

Raw variant Created Deleted
1 AluI, ApeKI, BbvI, Fnu4HI, TseI

Experimental services

Genomic description: 3593C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 494 -442 52
2 495 806 53 364
3 807 917 365 475
4 918 1070 476 628
5 1071 1202 629 760
6 1203 1343 761 901
7 1344 1472 902 1030
8 1473 1624 1031 1182
9 1625 1769 1183 1327
10 1770 1931 1328 1489
11 1932 2066 1490 1624
12 2067 2351 1625 1909
13 2352 2651 1910 2209
14 2652 2806 2210 2364
15 2807 3017 2365 2575
16 3018 3128 2576 2686
17 3129 3319 2687 2877
18 3320 3433 2878 2991
19 3434 3504 2992 3062
20 3505 3545 3063 3103
21 3546 3642 3104 3200
22 3643 3742 3201 3300
23 3743 4759 3301 *942

CDS information

g. c.
Start 443 1
Stop 3817 3375

Links

Download this reference sequence file: NM_000459.3.gb


Name ID Locus tag Product Link method
TEK_v001 NM_000459.3 exhaustion
TEK_i001 NP_000450.2 angiopoietin-1 receptor precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.