Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1168

TATTAAGGAAGAGGCAGGGTTCAAG A GGAGCCATGGGGCACTACGTCTTAG
TATTAAGGAAGAGGCAGGGTTCAAG C GGAGCCATGGGGCACTACGTCTTAG

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000410.3:n.1168A>C

Affected transcripts - 1

Affected proteins - 1

NM_000410.3(HFE_i001):p.(Arg336Ser)

Reference protein

  1  MGPRARPALL LLMLLQTAVL QGRLLRSHSL HYLFMGASEQ DLGLSLFEAL GYVDDQLFVF
61 YDHESRRVEP RTPWVSSRIS SQMWLQLSQS LKGWDHMFTV DFWTIMENHN HSKESHTLQV
121 ILGCEMQEDN STEGYWKYGY DGQDHLEFCP DTLDWRAAEP RAWPTKLEWE RHKIRARQNR
181 AYLERDCPAQ LQQLLELGRG VLDQQVPPLV KVTHHVTSSV TTLRCRALNY YPQNITMKWL
241 KDKQPMDAKE FEPKDVLPNG DGTYQGWITL AVPPGEEQRY TCQVEHPGLD QPLIVIWEPS
301 PSGTLVIGVI SGIAVFVVIL FIGILFIILR KRQGSRGAMG HYVLAERE*

Protein predicted from variant coding sequence

  1  MGPRARPALL LLMLLQTAVL QGRLLRSHSL HYLFMGASEQ DLGLSLFEAL GYVDDQLFVF
61 YDHESRRVEP RTPWVSSRIS SQMWLQLSQS LKGWDHMFTV DFWTIMENHN HSKESHTLQV
121 ILGCEMQEDN STEGYWKYGY DGQDHLEFCP DTLDWRAAEP RAWPTKLEWE RHKIRARQNR
181 AYLERDCPAQ LQQLLELGRG VLDQQVPPLV KVTHHVTSSV TTLRCRALNY YPQNITMKWL
241 KDKQPMDAKE FEPKDVLPNG DGTYQGWITL AVPPGEEQRY TCQVEHPGLD QPLIVIWEPS
301 PSGTLVIGVI SGIAVFVVIL FIGILFIILR KRQGSSGAMG HYVLAERE*

Effects on Restriction sites

Raw variant Created Deleted
1 AciI BseRI, Hpy188III

Experimental services

Genomic description: 1168A>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 236 -160 76
2 237 500 77 340
3 501 776 341 616
4 777 1052 617 892
5 1053 1166 893 1006
6 1167 2222 1007 *1015

CDS information

g. c.
Start 161 1
Stop 1207 1047

Links

Download this reference sequence file: NM_000410.3.gb


Name ID Locus tag Product Link method
HFE_v001 NM_000410.3 exhaustion
HFE_i001 NP_000401.1 hereditary hemochromatosis protein isoform 1 precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.