Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1548

CATTGCTAATTACCTGATGGAACAG A TTCAAGATGACTGCACTGGGGATGA
CATTGCTAATTACCTGATGGAACAG G TTCAAGATGACTGCACTGGGGATGA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000384.2:n.1548A>G

Affected transcripts - 1

Affected proteins - 1

NM_000384.2(APOB_i001):p.(Ile474Val)

Reference protein

   1  MDPPRPALLA LLALPALLLL LLAGARAEEE MLENVSLVCP KDATRFKHLR KYTYNYEAES
61 SSGVPGTADS RSATRINCKV ELEVPQLCSF ILKTSQCTLK EVYGFNPEGK ALLKKTKNSE
121 EFAAAMSRYE LKLAIPEGKQ VFLYPEKDEP TYILNIKRGI ISALLVPPET EEAKQVLFLD
181 TVYGNCSTHF TVKTRKGNVA TEISTERDLG QCDRFKPIRT GISPLALIKG MTRPLSTLIS
241 SSQSCQYTLD AKRKHVAEAI CKEQHLFLPF SYKNKYGMVA QVTQTLKLED TPKINSRFFG
301 EGTKKMGLAF ESTKSTSPPK QAEAVLKTLQ ELKKLTISEQ NIQRANLFNK LVTELRGLSD
361 EAVTSLLPQL IEVSSPITLQ ALVQCGQPQC STHILQWLKR VHANPLLIDV VTYLVALIPE
421 PSAQQLREIF NMARDQRSRA TLYALSHAVN NYHKTNPTGT QELLDIANYL MEQIQDDCTG
481 DEDYTYLILR VIGNMGQTME QLTPELKSSI LKCVQSTKPS LMIQKAAIQA LRKMEPKDKD
541 QEVLLQTFLD DASPGDKRLA AYLMLMRSPS QADINKIVQI LPWEQNEQVK NFVASHIANI
601 LNSEELDIQD LKKLVKEALK ESQLPTVMDF RKFSRNYQLY KSVSLPSLDP ASAKIEGNLI
661 FDPNNYLPKE SMLKTTLTAF GFASADLIEI GLEGKGFEPT LEALFGKQGF FPDSVNKALY
721 WVNGQVPDGV SKVLVDHFGY TKDDKHEQDM VNGIMLSVEK LIKDLKSKEV PEARAYLRIL
781 GEELGFASLH DLQLLGKLLL MGARTLQGIP QMIGEVIRKG SKNDFFLHYI FMENAFELPT
841 GAGLQLQISS SGVIAPGAKA GVKLEVANMQ AELVAKPSVS VEFVTNMGII IPDFARSGVQ
901 MNTNFFHESG LEAHVALKAG KLKFIIPSPK RPVKLLSGGN TLHLVSTTKT EVIPPLIENR
961 QSWSVCKQVF PGLNYCTSGA YSNASSTDSA SYYPLTGDTR LELELRPTGE IEQYSVSATY
1021 ELQREDRALV DTLKFVTQAE GAKQTEATMT FKYNRQSMTL SSEVQIPDFD VDLGTILRVN
1081 DESTEGKTSY RLTLDIQNKK ITEVALMGHL SCDTKEERKI KGVISIPRLQ AEARSEILAH
1141 WSPAKLLLQM DSSATAYGST VSKRVAWHYD EEKIEFEWNT GTNVDTKKMT SNFPVDLSDY
1201 PKSLHMYANR LLDHRVPQTD MTFRHVGSKL IVAMSSWLQK ASGSLPYTQT LQDHLNSLKE
1261 FNLQNMGLPD FHIPENLFLK SDGRVKYTLN KNSLKIEIPL PFGGKSSRDL KMLETVRTPA
1321 LHFKSVGFHL PSREFQVPTF TIPKLYQLQV PLLGVLDLST NVYSNLYNWS ASYSGGNTST
1381 DHFSLRARYH MKADSVVDLL SYNVQGSGET TYDHKNTFTL SCDGSLRHKF LDSNIKFSHV
1441 EKLGNNPVSK GLLIFDASSS WGPQMSASVH LDSKKKQHLF VKEVKIDGQF RVSSFYAKGT
1501 YGLSCQRDPN TGRLNGESNL RFNSSYLQGT NQITGRYEDG TLSLTSTSDL QSGIIKNTAS
1561 LKYENYELTL KSDTNGKYKN FATSNKMDMT FSKQNALLRS EYQADYESLR FFSLLSGSLN
1621 SHGLELNADI LGTDKINSGA HKATLRIGQD GISTSATTNL KCSLLVLENE LNAELGLSGA
1681 SMKLTTNGRF REHNAKFSLD GKAALTELSL GSAYQAMILG VDSKNIFNFK VSQEGLKLSN
1741 DMMGSYAEMK FDHTNSLNIA GLSLDFSSKL DNIYSSDKFY KQTVNLQLQP YSLVTTLNSD
1801 LKYNALDLTN NGKLRLEPLK LHVAGNLKGA YQNNEIKHIY AISSAALSAS YKADTVAKVQ
1861 GVEFSHRLNT DIAGLASAID MSTNYNSDSL HFSNVFRSVM APFTMTIDAH TNGNGKLALW
1921 GEHTGQLYSK FLLKAEPLAF TFSHDYKGST SHHLVSRKSI SAALEHKVSA LLTPAEQTGT
1981 WKLKTQFNNN EYSQDLDAYN TKDKIGVELT GRTLADLTLL DSPIKVPLLL SEPINIIDAL
2041 EMRDAVEKPQ EFTIVAFVKY DKNQDVHSIN LPFFETLQEY FERNRQTIIV VLENVQRNLK
2101 HINIDQFVRK YRAALGKLPQ QANDYLNSFN WERQVSHAKE KLTALTKKYR ITENDIQIAL
2161 DDAKINFNEK LSQLQTYMIQ FDQYIKDSYD LHDLKIAIAN IIDEIIEKLK SLDEHYHIRV
2221 NLVKTIHDLH LFIENIDFNK SGSSTASWIQ NVDTKYQIRI QIQEKLQQLK RHIQNIDIQH
2281 LAGKLKQHIE AIDVRVLLDQ LGTTISFERI NDVLEHVKHF VINLIGDFEV AEKINAFRAK
2341 VHELIERYEV DQQIQVLMDK LVELAHQYKL KETIQKLSNV LQQVKIKDYF EKLVGFIDDA
2401 VKKLNELSFK TFIEDVNKFL DMLIKKLKSF DYHQFVDETN DKIREVTQRL NGEIQALELP
2461 QKAEALKLFL EETKATVAVY LESLQDTKIT LIINWLQEAL SSASLAHMKA KFRETLEDTR
2521 DRMYQMDIQQ ELQRYLSLVG QVYSTLVTYI SDWWTLAAKN LTDFAEQYSI QDWAKRMKAL
2581 VEQGFTVPEI KTILGTMPAF EVSLQALQKA TFQTPDFIVP LTDLRIPSVQ INFKDLKNIK
2641 IPSRFSTPEF TILNTFHIPS FTIDFVEMKV KIIRTIDQML NSELQWPVPD IYLRDLKVED
2701 IPLARITLPD FRLPEIAIPE FIIPTLNLND FQVPDLHIPE FQLPHISHTI EVPTFGKLYS
2761 ILKIQSPLFT LDANADIGNG TTSANEAGIA ASITAKGESK LEVLNFDFQA NAQLSNPKIN
2821 PLALKESVKF SSKYLRTEHG SEMLFFGNAI EGKSNTVASL HTEKNTLELS NGVIVKINNQ
2881 LTLDSNTKYF HKLNIPKLDF SSQADLRNEI KTLLKAGHIA WTSSGKGSWK WACPRFSDEG
2941 THESQISFTI EGPLTSFGLS NKINSKHLRV NQNLVYESGS LNFSKLEIQS QVDSQHVGHS
3001 VLTAKGMALF GEGKAEFTGR HDAHLNGKVI GTLKNSLFFS AQPFEITAST NNEGNLKVRF
3061 PLRLTGKIDF LNNYALFLSP SAQQASWQVS ARFNQYKYNQ NFSAGNNENI MEAHVGINGE
3121 ANLDFLNIPL TIPEMRLPYT IITTPPLKDF SLWEKTGLKE FLKTTKQSFD LSVKAQYKKN
3181 KHRHSITNPL AVLCEFISQS IKSFDRHFEK NRNNALDFVT KSYNETKIKF DKYKAEKSHD
3241 ELPRTFQIPG YTVPVVNVEV SPFTIEMSAF GYVFPKAVSM PSFSILGSDV RVPSYTLILP
3301 SLELPVLHVP RNLKLSLPDF KELCTISHIF IPAMGNITYD FSFKSSVITL NTNAELFNQS
3361 DIVAHLLSSS SSVIDALQYK LEGTTRLTRK RGLKLATALS LSNKFVEGSH NSTVSLTTKN
3421 MEVSVATTTK AQIPILRMNF KQELNGNTKS KPTVSSSMEF KYDFNSSMLY STAKGAVDHK
3481 LSLESLTSYF SIESSTKGDV KGSVLSREYS GTIASEANTY LNSKSTRSSV KLQGTSKIDD
3541 IWNLEVKENF AGEATLQRIY SLWEHSTKNH LQLEGLFFTN GEHTSKATLE LSPWQMSALV
3601 QVHASQPSSF HDFPDLGQEV ALNANTKNQK IRWKNEVRIH SGSFQSQVEL SNDQEKAHLD
3661 IAGSLEGHLR FLKNIILPVY DKSLWDFLKL DVTTSIGRRQ HLRVSTAFVY TKNPNGYSFS
3721 IPVKVLADKF IIPGLKLNDL NSVLVMPTFH VPFTDLQVPS CKLDFREIQI YKKLRTSSFA
3781 LNLPTLPEVK FPEVDVLTKY SQPEDSLIPF FEITVPESQL TVSQFTLPKS VSDGIAALDL
3841 NAVANKIADF ELPTIIVPEQ TIEIPSIKFS VPAGIVIPSF QALTARFEVD SPVYNATWSA
3901 SLKNKADYVE TVLDSTCSST VQFLEYELNV LGTHKIEDGT LASKTKGTFA HRDFSAEYEE
3961 DGKYEGLQEW EGKAHLNIKS PAFTDLHLRY QKDKKGISTS AASPAVGTVG MDMDEDDDFS
4021 KWNFYYSPQS SPDKKLTIFK TELRVRESDE ETQIKVNWEE EAASGLLTSL KDNVPKATGV
4081 LYDYVNKYHW EHTGLTLREV SSKLRRNLQN NAEWVYQGAI RQIDDIDVRF QKAASGTTGT
4141 YQEWKDKAQN LYQELLTQEG QASFQGLKDN VFDGLVRVTQ EFHMKVKHLI DSLIDFLNFP
4201 RFQFPGKPGI YTREELCTMF IREVGTVLSQ VYSKVHNGSE ILFSYFQDLV ITLPFELRKH
4261 KLIDVISMYR ELLKDLSKEA QEVFKAIQSL KTTEVLRNLQ DLLQFIFQLI EDNIKQLKEM
4321 KFTYLINYIQ DEINTIFSDY IPYVFKLLKE NLCLNLHKFN EFIQNELQEA SQELQQIHQY
4381 IMALREEYFD PSIVGWTVKY YELEEKIVSL IKNLLVALKD FHSEYIVSAS NFTSQLSSQV
4441 EQFLHRNIQE YLSILTDPDG KGKEKIAELS ATAQEIIKSQ AIATKKIISD YHQQFRYKLQ
4501 DFSDQLSDYY EKFIAESKRL IDLSIQNYHT FLIYITELLK KLQSTTVMNP YMKLAPGELT
4561 IIL*

Protein predicted from variant coding sequence

   1  MDPPRPALLA LLALPALLLL LLAGARAEEE MLENVSLVCP KDATRFKHLR KYTYNYEAES
61 SSGVPGTADS RSATRINCKV ELEVPQLCSF ILKTSQCTLK EVYGFNPEGK ALLKKTKNSE
121 EFAAAMSRYE LKLAIPEGKQ VFLYPEKDEP TYILNIKRGI ISALLVPPET EEAKQVLFLD
181 TVYGNCSTHF TVKTRKGNVA TEISTERDLG QCDRFKPIRT GISPLALIKG MTRPLSTLIS
241 SSQSCQYTLD AKRKHVAEAI CKEQHLFLPF SYKNKYGMVA QVTQTLKLED TPKINSRFFG
301 EGTKKMGLAF ESTKSTSPPK QAEAVLKTLQ ELKKLTISEQ NIQRANLFNK LVTELRGLSD
361 EAVTSLLPQL IEVSSPITLQ ALVQCGQPQC STHILQWLKR VHANPLLIDV VTYLVALIPE
421 PSAQQLREIF NMARDQRSRA TLYALSHAVN NYHKTNPTGT QELLDIANYL MEQVQDDCTG
481 DEDYTYLILR VIGNMGQTME QLTPELKSSI LKCVQSTKPS LMIQKAAIQA LRKMEPKDKD
541 QEVLLQTFLD DASPGDKRLA AYLMLMRSPS QADINKIVQI LPWEQNEQVK NFVASHIANI
601 LNSEELDIQD LKKLVKEALK ESQLPTVMDF RKFSRNYQLY KSVSLPSLDP ASAKIEGNLI
661 FDPNNYLPKE SMLKTTLTAF GFASADLIEI GLEGKGFEPT LEALFGKQGF FPDSVNKALY
721 WVNGQVPDGV SKVLVDHFGY TKDDKHEQDM VNGIMLSVEK LIKDLKSKEV PEARAYLRIL
781 GEELGFASLH DLQLLGKLLL MGARTLQGIP QMIGEVIRKG SKNDFFLHYI FMENAFELPT
841 GAGLQLQISS SGVIAPGAKA GVKLEVANMQ AELVAKPSVS VEFVTNMGII IPDFARSGVQ
901 MNTNFFHESG LEAHVALKAG KLKFIIPSPK RPVKLLSGGN TLHLVSTTKT EVIPPLIENR
961 QSWSVCKQVF PGLNYCTSGA YSNASSTDSA SYYPLTGDTR LELELRPTGE IEQYSVSATY
1021 ELQREDRALV DTLKFVTQAE GAKQTEATMT FKYNRQSMTL SSEVQIPDFD VDLGTILRVN
1081 DESTEGKTSY RLTLDIQNKK ITEVALMGHL SCDTKEERKI KGVISIPRLQ AEARSEILAH
1141 WSPAKLLLQM DSSATAYGST VSKRVAWHYD EEKIEFEWNT GTNVDTKKMT SNFPVDLSDY
1201 PKSLHMYANR LLDHRVPQTD MTFRHVGSKL IVAMSSWLQK ASGSLPYTQT LQDHLNSLKE
1261 FNLQNMGLPD FHIPENLFLK SDGRVKYTLN KNSLKIEIPL PFGGKSSRDL KMLETVRTPA
1321 LHFKSVGFHL PSREFQVPTF TIPKLYQLQV PLLGVLDLST NVYSNLYNWS ASYSGGNTST
1381 DHFSLRARYH MKADSVVDLL SYNVQGSGET TYDHKNTFTL SCDGSLRHKF LDSNIKFSHV
1441 EKLGNNPVSK GLLIFDASSS WGPQMSASVH LDSKKKQHLF VKEVKIDGQF RVSSFYAKGT
1501 YGLSCQRDPN TGRLNGESNL RFNSSYLQGT NQITGRYEDG TLSLTSTSDL QSGIIKNTAS
1561 LKYENYELTL KSDTNGKYKN FATSNKMDMT FSKQNALLRS EYQADYESLR FFSLLSGSLN
1621 SHGLELNADI LGTDKINSGA HKATLRIGQD GISTSATTNL KCSLLVLENE LNAELGLSGA
1681 SMKLTTNGRF REHNAKFSLD GKAALTELSL GSAYQAMILG VDSKNIFNFK VSQEGLKLSN
1741 DMMGSYAEMK FDHTNSLNIA GLSLDFSSKL DNIYSSDKFY KQTVNLQLQP YSLVTTLNSD
1801 LKYNALDLTN NGKLRLEPLK LHVAGNLKGA YQNNEIKHIY AISSAALSAS YKADTVAKVQ
1861 GVEFSHRLNT DIAGLASAID MSTNYNSDSL HFSNVFRSVM APFTMTIDAH TNGNGKLALW
1921 GEHTGQLYSK FLLKAEPLAF TFSHDYKGST SHHLVSRKSI SAALEHKVSA LLTPAEQTGT
1981 WKLKTQFNNN EYSQDLDAYN TKDKIGVELT GRTLADLTLL DSPIKVPLLL SEPINIIDAL
2041 EMRDAVEKPQ EFTIVAFVKY DKNQDVHSIN LPFFETLQEY FERNRQTIIV VLENVQRNLK
2101 HINIDQFVRK YRAALGKLPQ QANDYLNSFN WERQVSHAKE KLTALTKKYR ITENDIQIAL
2161 DDAKINFNEK LSQLQTYMIQ FDQYIKDSYD LHDLKIAIAN IIDEIIEKLK SLDEHYHIRV
2221 NLVKTIHDLH LFIENIDFNK SGSSTASWIQ NVDTKYQIRI QIQEKLQQLK RHIQNIDIQH
2281 LAGKLKQHIE AIDVRVLLDQ LGTTISFERI NDVLEHVKHF VINLIGDFEV AEKINAFRAK
2341 VHELIERYEV DQQIQVLMDK LVELAHQYKL KETIQKLSNV LQQVKIKDYF EKLVGFIDDA
2401 VKKLNELSFK TFIEDVNKFL DMLIKKLKSF DYHQFVDETN DKIREVTQRL NGEIQALELP
2461 QKAEALKLFL EETKATVAVY LESLQDTKIT LIINWLQEAL SSASLAHMKA KFRETLEDTR
2521 DRMYQMDIQQ ELQRYLSLVG QVYSTLVTYI SDWWTLAAKN LTDFAEQYSI QDWAKRMKAL
2581 VEQGFTVPEI KTILGTMPAF EVSLQALQKA TFQTPDFIVP LTDLRIPSVQ INFKDLKNIK
2641 IPSRFSTPEF TILNTFHIPS FTIDFVEMKV KIIRTIDQML NSELQWPVPD IYLRDLKVED
2701 IPLARITLPD FRLPEIAIPE FIIPTLNLND FQVPDLHIPE FQLPHISHTI EVPTFGKLYS
2761 ILKIQSPLFT LDANADIGNG TTSANEAGIA ASITAKGESK LEVLNFDFQA NAQLSNPKIN
2821 PLALKESVKF SSKYLRTEHG SEMLFFGNAI EGKSNTVASL HTEKNTLELS NGVIVKINNQ
2881 LTLDSNTKYF HKLNIPKLDF SSQADLRNEI KTLLKAGHIA WTSSGKGSWK WACPRFSDEG
2941 THESQISFTI EGPLTSFGLS NKINSKHLRV NQNLVYESGS LNFSKLEIQS QVDSQHVGHS
3001 VLTAKGMALF GEGKAEFTGR HDAHLNGKVI GTLKNSLFFS AQPFEITAST NNEGNLKVRF
3061 PLRLTGKIDF LNNYALFLSP SAQQASWQVS ARFNQYKYNQ NFSAGNNENI MEAHVGINGE
3121 ANLDFLNIPL TIPEMRLPYT IITTPPLKDF SLWEKTGLKE FLKTTKQSFD LSVKAQYKKN
3181 KHRHSITNPL AVLCEFISQS IKSFDRHFEK NRNNALDFVT KSYNETKIKF DKYKAEKSHD
3241 ELPRTFQIPG YTVPVVNVEV SPFTIEMSAF GYVFPKAVSM PSFSILGSDV RVPSYTLILP
3301 SLELPVLHVP RNLKLSLPDF KELCTISHIF IPAMGNITYD FSFKSSVITL NTNAELFNQS
3361 DIVAHLLSSS SSVIDALQYK LEGTTRLTRK RGLKLATALS LSNKFVEGSH NSTVSLTTKN
3421 MEVSVATTTK AQIPILRMNF KQELNGNTKS KPTVSSSMEF KYDFNSSMLY STAKGAVDHK
3481 LSLESLTSYF SIESSTKGDV KGSVLSREYS GTIASEANTY LNSKSTRSSV KLQGTSKIDD
3541 IWNLEVKENF AGEATLQRIY SLWEHSTKNH LQLEGLFFTN GEHTSKATLE LSPWQMSALV
3601 QVHASQPSSF HDFPDLGQEV ALNANTKNQK IRWKNEVRIH SGSFQSQVEL SNDQEKAHLD
3661 IAGSLEGHLR FLKNIILPVY DKSLWDFLKL DVTTSIGRRQ HLRVSTAFVY TKNPNGYSFS
3721 IPVKVLADKF IIPGLKLNDL NSVLVMPTFH VPFTDLQVPS CKLDFREIQI YKKLRTSSFA
3781 LNLPTLPEVK FPEVDVLTKY SQPEDSLIPF FEITVPESQL TVSQFTLPKS VSDGIAALDL
3841 NAVANKIADF ELPTIIVPEQ TIEIPSIKFS VPAGIVIPSF QALTARFEVD SPVYNATWSA
3901 SLKNKADYVE TVLDSTCSST VQFLEYELNV LGTHKIEDGT LASKTKGTFA HRDFSAEYEE
3961 DGKYEGLQEW EGKAHLNIKS PAFTDLHLRY QKDKKGISTS AASPAVGTVG MDMDEDDDFS
4021 KWNFYYSPQS SPDKKLTIFK TELRVRESDE ETQIKVNWEE EAASGLLTSL KDNVPKATGV
4081 LYDYVNKYHW EHTGLTLREV SSKLRRNLQN NAEWVYQGAI RQIDDIDVRF QKAASGTTGT
4141 YQEWKDKAQN LYQELLTQEG QASFQGLKDN VFDGLVRVTQ EFHMKVKHLI DSLIDFLNFP
4201 RFQFPGKPGI YTREELCTMF IREVGTVLSQ VYSKVHNGSE ILFSYFQDLV ITLPFELRKH
4261 KLIDVISMYR ELLKDLSKEA QEVFKAIQSL KTTEVLRNLQ DLLQFIFQLI EDNIKQLKEM
4321 KFTYLINYIQ DEINTIFSDY IPYVFKLLKE NLCLNLHKFN EFIQNELQEA SQELQQIHQY
4381 IMALREEYFD PSIVGWTVKY YELEEKIVSL IKNLLVALKD FHSEYIVSAS NFTSQLSSQV
4441 EQFLHRNIQE YLSILTDPDG KGKEKIAELS ATAQEIIKSQ AIATKKIISD YHQQFRYKLQ
4501 DFSDQLSDYY EKFIAESKRL IDLSIQNYHT FLIYITELLK KLQSTTVMNP YMKLAPGELT
4561 IIL*

Effects on Restriction sites

Raw variant Created Deleted
1 HinfI, TfiI

Experimental services

Genomic description: 1548A>G

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 210 -128 82
2 211 249 83 121
3 250 365 122 237
4 366 511 238 383
5 512 665 384 537
6 666 821 538 693
7 822 946 694 818
8 947 1032 819 904
9 1033 1252 905 1124
10 1253 1480 1125 1352
11 1481 1598 1353 1470
12 1599 1745 1471 1617
13 1746 1957 1618 1829
14 1958 2195 1830 2067
15 2196 2372 2068 2244
16 2373 2564 2245 2436
17 2565 2732 2437 2604
18 2733 2944 2605 2816
19 2945 3127 2817 2999
20 3128 3249 3000 3121
21 3250 3460 3122 3332
22 3461 3636 3333 3508
23 3637 3824 3509 3696
24 3825 3970 3697 3842
25 3971 4344 3843 4216
26 4345 11916 4217 11788
27 11917 12031 11789 11903
28 12032 12215 11904 12087
29 12216 14121 12088 *301

CDS information

g. c.
Start 129 1
Stop 13820 13692

Links

Download this reference sequence file: NM_000384.2.gb


Name ID Locus tag Product Link method
APOB_v001 NM_000384.2 exhaustion
APOB_i001 NP_000375.2 apolipoprotein B-100 precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.