Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 351

AACCAAACAGGGTGTGGCAGAAGCA G CAGGAAAGACAAAAGAGGGTGTTCT
AACCAAACAGGGTGTGGCAGAAGCA C CAGGAAAGACAAAAGAGGGTGTTCT

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000345.3:n.351G>C

Affected transcripts - 1

Affected proteins - 1

NM_000345.3(SNCA_i001):p.(Ala30Pro)

Reference protein

  1  MDVFMKGLSK AKEGVVAAAE KTKQGVAEAA GKTKEGVLYV GSKTKEGVVH GVATVAEKTK
61 EQVTNVGGAV VTGVTAVAQK TVEGAGSIAA ATGFVKKDQL GKNEEGAPQE GILEDMPVDP
121 DNEAYEMPSE EGYQDYEPEA *

Protein predicted from variant coding sequence

  1  MDVFMKGLSK AKEGVVAAAE KTKQGVAEAP GKTKEGVLYV GSKTKEGVVH GVATVAEKTK
61 EQVTNVGGAV VTGVTAVAQK TVEGAGSIAA ATGFVKKDQL GKNEEGAPQE GILEDMPVDP
121 DNEAYEMPSE EGYQDYEPEA *

Effects on Restriction sites

Raw variant Created Deleted
1 BstNI, PspGI, ScrFI, StyD4I ApeKI, BbvI, Fnu4HI, MwoI, TseI

Experimental services

Genomic description: 351G>C

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 238 -263 -26
2 239 384 -25 121
3 385 426 122 163
4 427 569 164 306
5 570 653 307 390
6 654 3215 391 *2529

CDS information

g. c.
Start 264 1
Stop 686 423

Links

Download this reference sequence file: NM_000345.3.gb


Name ID Locus tag Product Link method
SNCA_v001 NM_000345.3 exhaustion
SNCA_i001 NP_000336.1 alpha-synuclein isoform NACP140 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.