Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1488

TTTGGGCTCTGCAAACAAGGAGACT C CATAAAGGCATATGGTGCTGGGCTC
TTTGGGCTCTGCAAACAAGGAGACT T CATAAAGGCATATGGTGCTGGGCTC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000277.1:n.1488C>T

Affected transcripts - 1

Affected proteins - 1

NM_000277.1(PAH_i001):p.(Ser339Phe)

Reference protein

  1  MSTAVLENPG LGRKLSDFGQ ETSYIEDNCN QNGAISLIFS LKEEVGALAK VLRLFEENDV
61 NLTHIESRPS RLKKDEYEFF THLDKRSLPA LTNIIKILRH DIGATVHELS RDKKKDTVPW
121 FPRTIQELDR FANQILSYGA ELDADHPGFK DPVYRARRKQ FADIAYNYRH GQPIPRVEYM
181 EEEKKTWGTV FKTLKSLYKT HACYEYNHIF PLLEKYCGFH EDNIPQLEDV SQFLQTCTGF
241 RLRPVAGLLS SRDFLGGLAF RVFHCTQYIR HGSKPMYTPE PDICHELLGH VPLFSDRSFA
301 QFSQEIGLAS LGAPDEYIEK LATIYWFTVE FGLCKQGDSI KAYGAGLLSS FGELQYCLSE
361 KPKLLPLELE KTAIQNYTVT EFQPLYYVAE SFNDAKEKVR NFAATIPRPF SVRYDPYTQR
421 IEVLDNTQQL KILADSINSE IGILCSALQK IK*

Protein predicted from variant coding sequence

  1  MSTAVLENPG LGRKLSDFGQ ETSYIEDNCN QNGAISLIFS LKEEVGALAK VLRLFEENDV
61 NLTHIESRPS RLKKDEYEFF THLDKRSLPA LTNIIKILRH DIGATVHELS RDKKKDTVPW
121 FPRTIQELDR FANQILSYGA ELDADHPGFK DPVYRARRKQ FADIAYNYRH GQPIPRVEYM
181 EEEKKTWGTV FKTLKSLYKT HACYEYNHIF PLLEKYCGFH EDNIPQLEDV SQFLQTCTGF
241 RLRPVAGLLS SRDFLGGLAF RVFHCTQYIR HGSKPMYTPE PDICHELLGH VPLFSDRSFA
301 QFSQEIGLAS LGAPDEYIEK LATIYWFTVE FGLCKQGDFI KAYGAGLLSS FGELQYCLSE
361 KPKLLPLELE KTAIQNYTVT EFQPLYYVAE SFNDAKEKVR NFAATIPRPF SVRYDPYTQR
421 IEVLDNTQQL KILADSINSE IGILCSALQK IK*

Effects on Restriction sites

Raw variant Created Deleted
1 HinfI, MlyI, PleI

Experimental services

Genomic description: 1488C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 473 1831 1 1359

CDS information

g. c.
Start 473 1
Stop 1831 1359

Links

Download this reference sequence file: NM_000277.1.gb


Name ID Locus tag Product Link method
PAH_v001 NM_000277.1 construction
PAH_i001 NP_000268.1 phenylalanine-4-hydroxylase construction

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.