Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 661

TCCCACAGCAATGCACATTGCTGCT G CAATAGAAGTTCATGAAGTACTGTT
TCCCACAGCAATGCACATTGCTGCT A CAATAGAAGTTCATGAAGTACTGTT

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000143.3:n.661G>A

Affected transcripts - 1

Affected proteins - 1

NM_000143.3(FH_i001):p.(Ala200Thr)

Reference protein

  1  MYRALRLLAR SRPLVRAPAA ALASAPGLGG AAVPSFWPPN AARMASQNSF RIEYDTFGEL
61 KVPNDKYYGA QTVRSTMNFK IGGVTERMPT PVIKAFGILK RAAAEVNQDY GLDPKIANAI
121 MKAADEVAEG KLNDHFPLVV WQTGSGTQTN MNVNEVISNR AIEMLGGELG SKIPVHPNDH
181 VNKSQSSNDT FPTAMHIAAA IEVHEVLLPG LQKLHDALDA KSKEFAQIIK IGRTHTQDAV
241 PLTLGQEFSG YVQQVKYAMT RIKAAMPRIY ELAAGGTAVG TGLNTRIGFA EKVAAKVAAL
301 TGLPFVTAPN KFEALAAHDA LVELSGAMNT TACSLMKIAN DIRFLGSGPR SGLGELILPE
361 NEPGSSIMPG KVNPTQCEAM TMVAAQVMGN HVAVTVGGSN GHFELNVFKP MMIKNVLHSA
421 RLLGDASVSF TENCVVGIQA NTERINKLMN ESLMLVTALN PHIGYDKAAK IAKTAHKNGS
481 TLKETAIELG YLTAEQFDEW VKPKDMLGPK *

Protein predicted from variant coding sequence

  1  MYRALRLLAR SRPLVRAPAA ALASAPGLGG AAVPSFWPPN AARMASQNSF RIEYDTFGEL
61 KVPNDKYYGA QTVRSTMNFK IGGVTERMPT PVIKAFGILK RAAAEVNQDY GLDPKIANAI
121 MKAADEVAEG KLNDHFPLVV WQTGSGTQTN MNVNEVISNR AIEMLGGELG SKIPVHPNDH
181 VNKSQSSNDT FPTAMHIAAT IEVHEVLLPG LQKLHDALDA KSKEFAQIIK IGRTHTQDAV
241 PLTLGQEFSG YVQQVKYAMT RIKAAMPRIY ELAAGGTAVG TGLNTRIGFA EKVAAKVAAL
301 TGLPFVTAPN KFEALAAHDA LVELSGAMNT TACSLMKIAN DIRFLGSGPR SGLGELILPE
361 NEPGSSIMPG KVNPTQCEAM TMVAAQVMGN HVAVTVGGSN GHFELNVFKP MMIKNVLHSA
421 RLLGDASVSF TENCVVGIQA NTERINKLMN ESLMLVTALN PHIGYDKAAK IAKTAHKNGS
481 TLKETAIELG YLTAEQFDEW VKPKDMLGPK *

Effects on Restriction sites

Raw variant Created Deleted
1

Experimental services

Genomic description: 661G>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 195 -63 132
2 196 330 133 267
3 331 441 268 378
4 442 618 379 555
5 619 801 556 738
6 802 967 739 904
7 968 1171 905 1108
8 1172 1299 1109 1236
9 1300 1453 1237 1390
10 1454 1867 1391 *271

CDS information

g. c.
Start 64 1
Stop 1596 1533

Links

Download this reference sequence file: NM_000143.3.gb


Name ID Locus tag Product Link method
FH_v001 NM_000143.3 exhaustion
FH_i001 NP_000134.2 fumarate hydratase, mitochondrial exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.