Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 1801

TCCCGGAAGTCAAGGAGAAAGTGGT C GACCAGGTCCTCCTGGGCCATCTGG
TCCCGGAAGTCAAGGAGAAAGTGGT T GACCAGGTCCTCCTGGGCCATCTGG

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000090.3:n.1801C>T

Affected transcripts - 1

Affected proteins - 1

NM_000090.3(COL3A1_i001):p.(Arg562*)

Reference protein

   1  MMSFVQKGSW LLLALLHPTI ILAQQEAVEG GCSHLGQSYA DRDVWKPEPC QICVCDSGSV
61 LCDDIICDDQ ELDCPNPEIP FGECCAVCPQ PPTAPTRPPN GQGPQGPKGD PGPPGIPGRN
121 GDPGIPGQPG SPGSPGPPGI CESCPTGPQN YSPQYDSYDV KSGVAVGGLA GYPGPAGPPG
181 PPGPPGTSGH PGSPGSPGYQ GPPGEPGQAG PSGPPGPPGA IGPSGPAGKD GESGRPGRPG
241 ERGLPGPPGI KGPAGIPGFP GMKGHRGFDG RNGEKGETGA PGLKGENGLP GENGAPGPMG
301 PRGAPGERGR PGLPGAAGAR GNDGARGSDG QPGPPGPPGT AGFPGSPGAK GEVGPAGSPG
361 SNGAPGQRGE PGPQGHAGAQ GPPGPPGING SPGGKGEMGP AGIPGAPGLM GARGPPGPAG
421 ANGAPGLRGG AGEPGKNGAK GEPGPRGERG EAGIPGVPGA KGEDGKDGSP GEPGANGLPG
481 AAGERGAPGF RGPAGPNGIP GEKGPAGERG APGPAGPRGA AGEPGRDGVP GGPGMRGMPG
541 SPGGPGSDGK PGPPGSQGES GRPGPPGPSG PRGQPGVMGF PGPKGNDGAP GKNGERGGPG
601 GPGPQGPPGK NGETGPQGPP GPTGPGGDKG DTGPPGPQGL QGLPGTGGPP GENGKPGEPG
661 PKGDAGAPGA PGGKGDAGAP GERGPPGLAG APGLRGGAGP PGPEGGKGAA GPPGPPGAAG
721 TPGLQGMPGE RGGLGSPGPK GDKGEPGGPG ADGVPGKDGP RGPTGPIGPP GPAGQPGDKG
781 EGGAPGLPGI AGPRGSPGER GETGPPGPAG FPGAPGQNGE PGGKGERGAP GEKGEGGPPG
841 VAGPPGGSGP AGPPGPQGVK GERGSPGGPG AAGFPGARGL PGPPGSNGNP GPPGPSGSPG
901 KDGPPGPAGN TGAPGSPGVS GPKGDAGQPG EKGSPGAQGP PGAPGPLGIA GITGARGLAG
961 PPGMPGPRGS PGPQGVKGES GKPGANGLSG ERGPPGPQGL PGLAGTAGEP GRDGNPGSDG
1021 LPGRDGSPGG KGDRGENGSP GAPGAPGHPG PPGPVGPAGK SGDRGESGPA GPAGAPGPAG
1081 SRGAPGPQGP RGDKGETGER GAAGIKGHRG FPGNPGAPGS PGPAGQQGAI GSPGPAGPRG
1141 PVGPSGPPGK DGTSGHPGPI GPPGPRGNRG ERGSEGSPGH PGQPGPPGPP GAPGPCCGGV
1201 GAAAIAGIGG EKAGGFAPYY GDEPMDFKIN TDEIMTSLKS VNGQIESLIS PDGSRKNPAR
1261 NCRDLKFCHP ELKSGEYWVD PNQGCKLDAI KVFCNMETGE TCISANPLNV PRKHWWTDSS
1321 AEKKHVWFGE SMDGGFQFSY GNPELPEDVL DVQLAFLRLL SSRASQNITY HCKNSIAYMD
1381 QASGNVKKAL KLMGSNEGEF KAEGNSKFTY TVLEDGCTKH TGEWSKTVFE YRTRKAVRLP
1441 IVDIAPYDIG GPDQEFGVDV GPVCFL*

Protein predicted from variant coding sequence

  1  MMSFVQKGSW LLLALLHPTI ILAQQEAVEG GCSHLGQSYA DRDVWKPEPC QICVCDSGSV
61 LCDDIICDDQ ELDCPNPEIP FGECCAVCPQ PPTAPTRPPN GQGPQGPKGD PGPPGIPGRN
121 GDPGIPGQPG SPGSPGPPGI CESCPTGPQN YSPQYDSYDV KSGVAVGGLA GYPGPAGPPG
181 PPGPPGTSGH PGSPGSPGYQ GPPGEPGQAG PSGPPGPPGA IGPSGPAGKD GESGRPGRPG
241 ERGLPGPPGI KGPAGIPGFP GMKGHRGFDG RNGEKGETGA PGLKGENGLP GENGAPGPMG
301 PRGAPGERGR PGLPGAAGAR GNDGARGSDG QPGPPGPPGT AGFPGSPGAK GEVGPAGSPG
361 SNGAPGQRGE PGPQGHAGAQ GPPGPPGING SPGGKGEMGP AGIPGAPGLM GARGPPGPAG
421 ANGAPGLRGG AGEPGKNGAK GEPGPRGERG EAGIPGVPGA KGEDGKDGSP GEPGANGLPG
481 AAGERGAPGF RGPAGPNGIP GEKGPAGERG APGPAGPRGA AGEPGRDGVP GGPGMRGMPG
541 SPGGPGSDGK PGPPGSQGES G*

Effects on Restriction sites

Raw variant Created Deleted
1 AccI, SalI, TaqI

Experimental services

Genomic description: 1801C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 196 -117 79
2 197 399 80 282
3 400 450 283 333
4 451 564 334 447
5 565 645 448 528
6 646 699 529 582
7 700 753 583 636
8 754 807 637 690
9 808 861 691 744
10 862 915 745 798
11 916 969 799 852
12 970 1014 853 897
13 1015 1068 898 951
14 1069 1113 952 996
15 1114 1167 997 1050
16 1168 1266 1051 1149
17 1267 1311 1150 1194
18 1312 1410 1195 1293
19 1411 1464 1294 1347
20 1465 1572 1348 1455
21 1573 1626 1456 1509
22 1627 1725 1510 1608
23 1726 1779 1609 1662
24 1780 1878 1663 1761
25 1879 1932 1762 1815
26 1933 1986 1816 1869
27 1987 2040 1870 1923
28 2041 2094 1924 1977
29 2095 2139 1978 2022
30 2140 2238 2023 2121
31 2239 2346 2122 2229
32 2347 2400 2230 2283
33 2401 2454 2284 2337
34 2455 2508 2338 2391
35 2509 2562 2392 2445
36 2563 2670 2446 2553
37 2671 2724 2554 2607
38 2725 2778 2608 2661
39 2779 2940 2662 2823
40 2941 3048 2824 2931
41 3049 3156 2932 3039
42 3157 3210 3040 3093
43 3211 3318 3094 3201
44 3319 3372 3202 3255
45 3373 3480 3256 3363
46 3481 3534 3364 3417
47 3535 3642 3418 3525
48 3643 3940 3526 3823
49 3941 4128 3824 4011
50 4129 4371 4012 4254
51 4372 5490 4255 *972

CDS information

g. c.
Start 118 1
Stop 4518 4401

Links

Download this reference sequence file: NM_000090.3.gb


Name ID Locus tag Product Link method
COL3A1_v001 NM_000090.3 exhaustion
COL3A1_i001 NP_000081.1 collagen alpha-1(III) chain preproprotein exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.