Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 101

CCTCCTGGCGCTCCTGGCCTCTGCC C GAGCTTCAGAGGCCGAGGATGCCTC
CCTCCTGGCGCTCCTGGCCTCTGCC T GAGCTTCAGAGGCCGAGGATGCCTC

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000040.1:n.101C>T

Affected transcripts - 1

Affected proteins - 1

NM_000040.1(APOC3_i001):p.(Arg19*)

Reference protein

  1  MQPRVLLVVA LLALLASARA SEAEDASLLS FMQGYMKHAT KTAKDALSSV QESQVAQQAR
61 GWVTDGFSSL KDYWSTVKDK FSEFWDLDPE VRPTSAVAA*

Protein predicted from variant coding sequence

 1  MQPRVLLVVA LLALLASA*

Effects on Restriction sites

Raw variant Created Deleted
1 Bpu10I, BspCNI, DdeI AvaI, BsoBI

Experimental services

Genomic description: 101C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 33 -46 -14
2 34 101 -13 55
3 102 225 56 179
4 226 533 180 *187

CDS information

g. c.
Start 47 1
Stop 346 300

Links

Download this reference sequence file: NM_000040.1.gb


Name ID Locus tag Product Link method
APOC3_v001 NM_000040.1 exhaustion
APOC3_i001 NP_000031.1 apolipoprotein C-III precursor exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.