Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 149

GCACCATGGCCCAGACGCCCGCCTT C GACAAGCCCAAAGTAGAACTGCATG
GCACCATGGCCCAGACGCCCGCCTT T GACAAGCCCAAAGTAGAACTGCATG

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000022.2:n.149C>T

Affected transcripts - 1

Affected proteins - 1

NM_000022.2(ADA_i001):p.(=)

Reference protein

  1  MAQTPAFDKP KVELHVHLDG SIKPETILYY GRRRGIALPA NTAEGLLNVI GMDKPLTLPD
61 FLAKFDYYMP AIAGCREAIK RIAYEFVEMK AKEGVVYVEV RYSPHLLANS KVEPIPWNQA
121 EGDLTPDEVV ALVGQGLQEG ERDFGVKARS ILCCMRHQPN WSPKVVELCK KYQQQTVVAI
181 DLAGDETIPG SSLLPGHVQA YQEAVKSGIH RTVHAGEVGS AEVVKEAVDI LKTERLGHGY
241 HTLEDQALYN RLRQENMHFE ICPWSSYLTG AWKPDTEHAV IRLKNDQANY SLNTDDPLIF
301 KSTLDTDYQM TKRDMGFTEE EFKRLNINAA KSSFLPEDEK RELLDLLYKA YGMPPSASAG
361 QNL*

Protein predicted from variant coding sequence

No change: predicted protein (not shown) equals reference protein.

Effects on Restriction sites

Raw variant Created Deleted
1 HpyAV, TaqI

Experimental services

Genomic description: 149C>T

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 161 -128 33
2 162 223 34 95
3 224 346 96 218
4 347 490 219 362
5 491 606 363 478
6 607 734 479 606
7 735 806 607 678
8 807 908 679 780
9 909 973 781 845
10 974 1103 846 975
11 1104 1206 976 1078
12 1207 1532 1079 *312

CDS information

g. c.
Start 129 1
Stop 1220 1092

Links

Download this reference sequence file: NM_000022.2.gb


Name ID Locus tag Product Link method
ADA_v001 NM_000022.2 exhaustion
ADA_i001 NP_000013.2 adenosine deaminase exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.