Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 949

ATCAAGTACCTCCCTGAATGGACTG C GTGGCTCATCTTGGCTGTGATTTCA
ATCAAGTACCTCCCTGAATGGACTG A GTGGCTCATCTTGGCTGTGATTTCA

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000021.4:n.949C>A

Affected transcripts - 1

Affected proteins - 1

NM_000021.4(PSEN1_i001):p.(Ala246Glu)

Reference protein

  1  MTELPAPLSY FQNAQMSEDN HLSNTVRSQN DNRERQEHND RRSLGHPEPL SNGRPQGNSR
61 QVVEQDEEED EELTLKYGAK HVIMLFVPVT LCMVVVVATI KSVSFYTRKD GQLIYTPFTE
121 DTETVGQRAL HSILNAAIMI SVIVVMTILL VVLYKYRCYK VIHAWLIISS LLLLFFFSFI
181 YLGEVFKTYN VAVDYITVAL LIWNFGVVGM ISIHWKGPLR LQQAYLIMIS ALMALVFIKY
241 LPEWTAWLIL AVISVYDLVA VLCPKGPLRM LVETAQERNE TLFPALIYSS TMVWLVNMAE
301 GDPEAQRRVS KNSKYNAEST ERESQDTVAE NDDGGFSEEW EAQRDSHLGP HRSTPESRAA
361 VQELSSSILA GEDPEERGVK LGLGDFIFYS VLVGKASATA SGDWNTTIAC FVAILIGLCL
421 TLLLLAIFKK ALPALPISIT FGLVFYFATD YLVQPFMDQL AFHQFYI*

Protein predicted from variant coding sequence

  1  MTELPAPLSY FQNAQMSEDN HLSNTVRSQN DNRERQEHND RRSLGHPEPL SNGRPQGNSR
61 QVVEQDEEED EELTLKYGAK HVIMLFVPVT LCMVVVVATI KSVSFYTRKD GQLIYTPFTE
121 DTETVGQRAL HSILNAAIMI SVIVVMTILL VVLYKYRCYK VIHAWLIISS LLLLFFFSFI
181 YLGEVFKTYN VAVDYITVAL LIWNFGVVGM ISIHWKGPLR LQQAYLIMIS ALMALVFIKY
241 LPEWTEWLIL AVISVYDLVA VLCPKGPLRM LVETAQERNE TLFPALIYSS TMVWLVNMAE
301 GDPEAQRRVS KNSKYNAEST ERESQDTVAE NDDGGFSEEW EAQRDSHLGP HRSTPESRAA
361 VQELSSSILA GEDPEERGVK LGLGDFIFYS VLVGKASATA SGDWNTTIAC FVAILIGLCL
421 TLLLLAIFKK ALPALPISIT FGLVFYFATD YLVQPFMDQL AFHQFYI*

Effects on Restriction sites

Raw variant Created Deleted
1 BspCNI, DdeI

Experimental services

Genomic description: 949C>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 77 -212 -136
2 78 159 -135 -54
3 160 299 -53 87
4 300 550 88 338
5 551 692 339 480
6 693 760 481 548
7 761 981 549 769
8 982 1080 770 868
9 1081 1167 869 955
10 1168 1341 956 1129
11 1342 1460 1130 1248
12 1461 6018 1249 *4402

CDS information

g. c.
Start 213 1
Stop 1616 1404

Links

Download this reference sequence file: NM_000021.4.gb


Name ID Locus tag Product Link method
PSEN1_v001 NM_000021.4 exhaustion
PSEN1_i001 NP_000012.1 presenilin-1 isoform I-467 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.