Check out the Mutalyzer 3 Alpha release!

Name Checker

Please insert a variant description using the HGVS format.

Examples: AB026906.1:c.40_42del, NG_012337.1(SDHD_v001):c.274G>T, LRG_24t1:c.159dup


0 Errors, 0 Warnings.


Overview of the raw variants

Raw variant 1: substitution at 722

TCATGATCAGTGTCATTGTTGTCAT G ACTATCCTCCTGGTGGTTCTGTATA
TCATGATCAGTGTCATTGTTGTCAT A ACTATCCTCCTGGTGGTTCTGTATA

View original variant in UCSC Genome Browser

Description relative to transcription start

(Not for use in LSDBs in case of protein-coding transcripts).

NM_000021.3:n.722G>A

Affected transcripts - 1

Affected proteins - 1

NM_000021.3(PSEN1_i001):p.(Met146Ile)

Reference protein

  1  MTELPAPLSY FQNAQMSEDN HLSNTVRSQN DNRERQEHND RRSLGHPEPL SNGRPQGNSR
61 QVVEQDEEED EELTLKYGAK HVIMLFVPVT LCMVVVVATI KSVSFYTRKD GQLIYTPFTE
121 DTETVGQRAL HSILNAAIMI SVIVVMTILL VVLYKYRCYK VIHAWLIISS LLLLFFFSFI
181 YLGEVFKTYN VAVDYITVAL LIWNFGVVGM ISIHWKGPLR LQQAYLIMIS ALMALVFIKY
241 LPEWTAWLIL AVISVYDLVA VLCPKGPLRM LVETAQERNE TLFPALIYSS TMVWLVNMAE
301 GDPEAQRRVS KNSKYNAEST ERESQDTVAE NDDGGFSEEW EAQRDSHLGP HRSTPESRAA
361 VQELSSSILA GEDPEERGVK LGLGDFIFYS VLVGKASATA SGDWNTTIAC FVAILIGLCL
421 TLLLLAIFKK ALPALPISIT FGLVFYFATD YLVQPFMDQL AFHQFYI*

Protein predicted from variant coding sequence

  1  MTELPAPLSY FQNAQMSEDN HLSNTVRSQN DNRERQEHND RRSLGHPEPL SNGRPQGNSR
61 QVVEQDEEED EELTLKYGAK HVIMLFVPVT LCMVVVVATI KSVSFYTRKD GQLIYTPFTE
121 DTETVGQRAL HSILNAAIMI SVIVVITILL VVLYKYRCYK VIHAWLIISS LLLLFFFSFI
181 YLGEVFKTYN VAVDYITVAL LIWNFGVVGM ISIHWKGPLR LQQAYLIMIS ALMALVFIKY
241 LPEWTAWLIL AVISVYDLVA VLCPKGPLRM LVETAQERNE TLFPALIYSS TMVWLVNMAE
301 GDPEAQRRVS KNSKYNAEST ERESQDTVAE NDDGGFSEEW EAQRDSHLGP HRSTPESRAA
361 VQELSSSILA GEDPEERGVK LGLGDFIFYS VLVGKASATA SGDWNTTIAC FVAILIGLCL
421 TLLLLAIFKK ALPALPISIT FGLVFYFATD YLVQPFMDQL AFHQFYI*

Effects on Restriction sites

Raw variant Created Deleted
1

Experimental services

Genomic description: 722G>A

Exon information

Number Start (g.) Stop (g.) Start (c.) Stop (c.)
1 1 149 -284 -136
2 150 231 -135 -54
3 232 371 -53 87
4 372 622 88 338
5 623 764 339 480
6 765 832 481 548
7 833 1053 549 769
8 1054 1152 770 868
9 1153 1239 869 955
10 1240 1413 956 1129
11 1414 1532 1130 1248
12 1533 6090 1249 *4402

CDS information

g. c.
Start 285 1
Stop 1688 1404

Links

Download this reference sequence file: NM_000021.3.gb


Name ID Locus tag Product Link method
PSEN1_v001 NM_000021.3 exhaustion
PSEN1_i001 NP_000012.1 presenilin-1 isoform I-467 exhaustion

Link methods priorities order: protein (NCBI), locus tag, product tag, exhaustion, and construction.